Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0429928046:

Variant ID: vg0429928046 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 29928046
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.75, A: 0.25, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:

TCAGCCCACTTGGTGAAGTAATCCGTAGCAACTAGCATGAACCTATGCCCCTTTGATGACGAAGGATAAATTTGACCAATGAAATCCAAAGCCCATCCTC[A/G]
GAACGGCTATGGTTTGATTATGGGATTCAACACGGCAGCGGGCGCCAATTGAACATTGCCGAACCGTTGACAAGCCTCGCATCCTCTATAATATTTGAAG

Reverse complement sequence

CTTCAAATATTATAGAGGATGCGAGGCTTGTCAACGGTTCGGCAATGTTCAATTGGCGCCCGCTGCCGTGTTGAATCCCATAATCAAACCATAGCCGTTC[T/C]
GAGGATGGGCTTTGGATTTCATTGGTCAAATTTATCCTTCGTCATCAAAGGGGCATAGGTTCATGCTAGTTGCTACGGATTACTTCACCAAGTGGGCTGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.80%	27.20%	0.00%	0.00%	NA
All Indica	2759	69.20%	30.80%	0.00%	0.00%	NA
All Japonica	1512	83.20%	16.80%	0.00%	0.00%	NA
Aus	269	45.00%	55.00%	0.00%	0.00%	NA
Indica I	595	80.50%	19.50%	0.00%	0.00%	NA
Indica II	465	34.20%	65.80%	0.00%	0.00%	NA
Indica III	913	78.30%	21.70%	0.00%	0.00%	NA
Indica Intermediate	786	70.90%	29.10%	0.00%	0.00%	NA
Temperate Japonica	767	92.60%	7.40%	0.00%	0.00%	NA
Tropical Japonica	504	92.70%	7.30%	0.00%	0.00%	NA
Japonica Intermediate	241	33.60%	66.40%	0.00%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	65.60%	34.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0429928046	A -> G	LOC_Os04g50168.1	upstream_gene_variant ; 2997.0bp to feature; MODIFIER	silent_mutation	Average:36.463; most accessible tissue: Callus, score: 47.188	N	N	N	N
vg0429928046	A -> G	LOC_Os04g50164.1	intron_variant ; MODIFIER	silent_mutation	Average:36.463; most accessible tissue: Callus, score: 47.188	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0429928046	NA	4.95E-06	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429928046	NA	8.49E-08	mr1138	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429928046	6.86E-08	4.76E-12	mr1169	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429928046	3.35E-10	6.32E-16	mr1169	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429928046	NA	1.30E-10	mr1174	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429928046	7.69E-11	3.00E-21	mr1174	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429928046	NA	5.74E-06	mr1347	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429928046	NA	1.68E-10	mr1347	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429928046	NA	1.59E-09	mr1354	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429928046	NA	7.76E-06	mr1406	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429928046	NA	1.90E-08	mr1406	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429928046	NA	2.79E-07	mr1745	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429928046	NA	3.21E-07	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429928046	NA	9.54E-07	mr1119_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429928046	NA	1.65E-06	mr1138_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429928046	NA	3.59E-10	mr1174_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429928046	3.08E-14	4.12E-29	mr1174_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429928046	NA	2.15E-06	mr1240_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429928046	7.17E-06	1.90E-09	mr1347_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429928046	4.27E-12	3.02E-26	mr1347_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429928046	NA	8.60E-10	mr1354_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429928046	NA	1.52E-06	mr1406_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429928046	1.01E-07	2.98E-11	mr1406_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429928046	NA	6.27E-06	mr1496_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429928046	NA	9.91E-06	mr1519_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429928046	NA	6.31E-07	mr1540_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429928046	NA	5.90E-07	mr1732_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429928046	NA	5.47E-06	mr1745_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251