\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0429869745:

Variant ID: vg0429869745 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 29869745
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.70, G: 0.29, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:


CTAGCATCACACACACAAAAACACACACACACATATATGAATCTAGACATATGTGTGTGTCTAGATTCATTAGCATTTATATGAATGCGGGCAATGCTAG[A/G]
AAGTCTTATAACCTGAAACAGATGTAGTACTTAATTAATCATATGGTAATGGATCATATCATATTATGTATTTCTCAATCTTCTCCTTTCTTCTTCCCTT

Reverse complement sequence

AAGGGAAGAAGAAAGGAGAAGATTGAGAAATACATAATATGATATGATCCATTACCATATGATTAATTAAGTACTACATCTGTTTCAGGTTATAAGACTT[T/C]
CTAGCATTGCCCGCATTCATATAAATGCTAATGAATCTAGACACACACATATGTCTAGATTCATATATGTGTGTGTGTGTTTTTGTGTGTGTGATGCTAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.30% 15.50% 0.19% 0.00% NA
All Indica  2759 73.60% 26.10% 0.29% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 81.50% 18.30% 0.17% 0.00% NA
Indica II  465 33.80% 65.60% 0.65% 0.00% NA
Indica III  913 84.70% 15.20% 0.11% 0.00% NA
Indica Intermediate  786 78.50% 21.10% 0.38% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 85.60% 13.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0429869745 A -> G LOC_Os04g50080.1 downstream_gene_variant ; 2591.0bp to feature; MODIFIER silent_mutation Average:38.309; most accessible tissue: Callus, score: 69.687 N N N N
vg0429869745 A -> G LOC_Os04g50080-LOC_Os04g50090 intergenic_region ; MODIFIER silent_mutation Average:38.309; most accessible tissue: Callus, score: 69.687 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0429869745 NA 6.06E-15 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429869745 NA 1.57E-08 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429869745 1.62E-09 2.49E-25 mr1169 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429869745 5.74E-08 1.39E-15 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429869745 9.80E-12 4.69E-26 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429869745 5.24E-14 4.03E-24 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429869745 1.77E-07 6.82E-12 mr1347 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429869745 1.50E-07 3.24E-12 mr1347 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429869745 NA 3.61E-11 mr1354 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429869745 NA 1.18E-10 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429869745 8.89E-06 NA mr1406 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429869745 4.89E-06 2.73E-08 mr1406 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429869745 NA 8.79E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429869745 NA 6.87E-15 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429869745 NA 4.99E-08 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429869745 7.20E-11 1.20E-27 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429869745 6.68E-14 6.27E-27 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429869745 3.50E-11 1.09E-21 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429869745 3.98E-12 4.38E-24 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429869745 NA 3.81E-11 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429869745 NA 7.55E-11 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429869745 1.95E-06 1.96E-07 mr1406_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429869745 7.82E-07 7.79E-10 mr1406_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429869745 NA 3.26E-06 mr1539_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429869745 NA 2.22E-08 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429869745 NA 8.32E-09 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251