\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0429856676:

Variant ID: vg0429856676 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 29856676
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.60, C: 0.39, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TTTAGTTTCCCTCTATTCCCAACTTTCCATCACATCATATCACATCAAAATTTTTTCTACACATATAAACTTTTAACTTTTTTTTCAAACTCCTAACTTT[T/C]
TTCAAACTTTCAACTTTTTTCAGGAACTAAACACACCCGACTCTCCAACATATTCTACTGTCGTACATGCGCATGAACGATGAATAACGAAACATATACG

Reverse complement sequence

CGTATATGTTTCGTTATTCATCGTTCATGCGCATGTACGACAGTAGAATATGTTGGAGAGTCGGGTGTGTTTAGTTCCTGAAAAAAGTTGAAAGTTTGAA[A/G]
AAAGTTAGGAGTTTGAAAAAAAAGTTAAAAGTTTATATGTGTAGAAAAAATTTTGATGTGATATGATGTGATGGAAAGTTGGGAATAGAGGGAAACTAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.40% 40.00% 0.55% 0.06% NA
All Indica  2759 56.80% 42.50% 0.62% 0.04% NA
All Japonica  1512 73.50% 26.10% 0.33% 0.13% NA
Aus  269 29.70% 70.30% 0.00% 0.00% NA
Indica I  595 78.30% 21.30% 0.34% 0.00% NA
Indica II  465 24.30% 75.30% 0.43% 0.00% NA
Indica III  913 58.40% 41.40% 0.22% 0.00% NA
Indica Intermediate  786 58.00% 40.50% 1.40% 0.13% NA
Temperate Japonica  767 55.00% 44.20% 0.65% 0.13% NA
Tropical Japonica  504 95.40% 4.40% 0.00% 0.20% NA
Japonica Intermediate  241 86.30% 13.70% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 95.80% 1.04% 0.00% NA
Intermediate  90 50.00% 46.70% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0429856676 T -> C LOC_Os04g50060.1 upstream_gene_variant ; 866.0bp to feature; MODIFIER silent_mutation Average:63.949; most accessible tissue: Callus, score: 96.341 N N N N
vg0429856676 T -> C LOC_Os04g50060.2 upstream_gene_variant ; 862.0bp to feature; MODIFIER silent_mutation Average:63.949; most accessible tissue: Callus, score: 96.341 N N N N
vg0429856676 T -> C LOC_Os04g50050.1 downstream_gene_variant ; 1789.0bp to feature; MODIFIER silent_mutation Average:63.949; most accessible tissue: Callus, score: 96.341 N N N N
vg0429856676 T -> C LOC_Os04g50050-LOC_Os04g50060 intergenic_region ; MODIFIER silent_mutation Average:63.949; most accessible tissue: Callus, score: 96.341 N N N N
vg0429856676 T -> DEL N N silent_mutation Average:63.949; most accessible tissue: Callus, score: 96.341 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0429856676 NA 4.94E-10 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429856676 1.98E-07 3.80E-16 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429856676 NA 1.55E-08 mr1347 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429856676 NA 2.83E-06 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429856676 NA 3.14E-07 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429856676 NA 2.75E-06 mr1127_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429856676 NA 4.56E-06 mr1167_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429856676 NA 8.53E-06 mr1169_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429856676 6.19E-08 1.45E-11 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429856676 8.60E-10 2.50E-23 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429856676 NA 1.13E-06 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429856676 5.51E-08 NA mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429856676 1.40E-09 3.14E-22 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429856676 1.30E-06 4.98E-06 mr1406_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429856676 NA 8.60E-09 mr1406_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429856676 NA 4.82E-10 mr1539_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429856676 NA 1.37E-10 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429856676 NA 4.87E-07 mr1558_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429856676 NA 1.81E-11 mr1565_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429856676 NA 4.19E-11 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429856676 NA 2.06E-06 mr1726_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429856676 NA 3.39E-10 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429856676 NA 6.67E-10 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251