\
| Variant ID: vg0429856676 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 29856676 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.60, C: 0.39, others allele: 0.00, population size: 103. )
TTTAGTTTCCCTCTATTCCCAACTTTCCATCACATCATATCACATCAAAATTTTTTCTACACATATAAACTTTTAACTTTTTTTTCAAACTCCTAACTTT[T/C]
TTCAAACTTTCAACTTTTTTCAGGAACTAAACACACCCGACTCTCCAACATATTCTACTGTCGTACATGCGCATGAACGATGAATAACGAAACATATACG
CGTATATGTTTCGTTATTCATCGTTCATGCGCATGTACGACAGTAGAATATGTTGGAGAGTCGGGTGTGTTTAGTTCCTGAAAAAAGTTGAAAGTTTGAA[A/G]
AAAGTTAGGAGTTTGAAAAAAAAGTTAAAAGTTTATATGTGTAGAAAAAATTTTGATGTGATATGATGTGATGGAAAGTTGGGAATAGAGGGAAACTAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.40% | 40.00% | 0.55% | 0.06% | NA |
| All Indica | 2759 | 56.80% | 42.50% | 0.62% | 0.04% | NA |
| All Japonica | 1512 | 73.50% | 26.10% | 0.33% | 0.13% | NA |
| Aus | 269 | 29.70% | 70.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 78.30% | 21.30% | 0.34% | 0.00% | NA |
| Indica II | 465 | 24.30% | 75.30% | 0.43% | 0.00% | NA |
| Indica III | 913 | 58.40% | 41.40% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 58.00% | 40.50% | 1.40% | 0.13% | NA |
| Temperate Japonica | 767 | 55.00% | 44.20% | 0.65% | 0.13% | NA |
| Tropical Japonica | 504 | 95.40% | 4.40% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 86.30% | 13.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 3.10% | 95.80% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 50.00% | 46.70% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0429856676 | T -> C | LOC_Os04g50060.1 | upstream_gene_variant ; 866.0bp to feature; MODIFIER | silent_mutation | Average:63.949; most accessible tissue: Callus, score: 96.341 | N | N | N | N |
| vg0429856676 | T -> C | LOC_Os04g50060.2 | upstream_gene_variant ; 862.0bp to feature; MODIFIER | silent_mutation | Average:63.949; most accessible tissue: Callus, score: 96.341 | N | N | N | N |
| vg0429856676 | T -> C | LOC_Os04g50050.1 | downstream_gene_variant ; 1789.0bp to feature; MODIFIER | silent_mutation | Average:63.949; most accessible tissue: Callus, score: 96.341 | N | N | N | N |
| vg0429856676 | T -> C | LOC_Os04g50050-LOC_Os04g50060 | intergenic_region ; MODIFIER | silent_mutation | Average:63.949; most accessible tissue: Callus, score: 96.341 | N | N | N | N |
| vg0429856676 | T -> DEL | N | N | silent_mutation | Average:63.949; most accessible tissue: Callus, score: 96.341 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0429856676 | NA | 4.94E-10 | mr1169 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429856676 | 1.98E-07 | 3.80E-16 | mr1174 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429856676 | NA | 1.55E-08 | mr1347 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429856676 | NA | 2.83E-06 | mr1354 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429856676 | NA | 3.14E-07 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429856676 | NA | 2.75E-06 | mr1127_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429856676 | NA | 4.56E-06 | mr1167_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429856676 | NA | 8.53E-06 | mr1169_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429856676 | 6.19E-08 | 1.45E-11 | mr1174_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429856676 | 8.60E-10 | 2.50E-23 | mr1174_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429856676 | NA | 1.13E-06 | mr1243_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429856676 | 5.51E-08 | NA | mr1347_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429856676 | 1.40E-09 | 3.14E-22 | mr1347_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429856676 | 1.30E-06 | 4.98E-06 | mr1406_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429856676 | NA | 8.60E-09 | mr1406_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429856676 | NA | 4.82E-10 | mr1539_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429856676 | NA | 1.37E-10 | mr1540_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429856676 | NA | 4.87E-07 | mr1558_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429856676 | NA | 1.81E-11 | mr1565_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429856676 | NA | 4.19E-11 | mr1565_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429856676 | NA | 2.06E-06 | mr1726_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429856676 | NA | 3.39E-10 | mr1732_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429856676 | NA | 6.67E-10 | mr1739_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |