\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0429843384:

Variant ID: vg0429843384 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 29843384
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 322. )

Flanking Sequence (100 bp) in Reference Genome:


GGCATGTAGCCCATGGTCGTTCGTGATTTGGGATATGTCACCGAGAAATGCTGTCGGCTAGCAGAATCGTAGTAACCCCGTTATTTGTTTTGTTGCAACC[C/T]
TTTGTCCTCCCGTCTGGTCCTTTCAGTCCTGGCTAGGGTTGCACAGTGTTATTCGCGGCTAATGGGCATCATATGCACTTTTGGCTTACTGTGCATGTAC

Reverse complement sequence

GTACATGCACAGTAAGCCAAAAGTGCATATGATGCCCATTAGCCGCGAATAACACTGTGCAACCCTAGCCAGGACTGAAAGGACCAGACGGGAGGACAAA[G/A]
GGTTGCAACAAAACAAATAACGGGGTTACTACGATTCTGCTAGCCGACAGCATTTCTCGGTGACATATCCCAAATCACGAACGACCATGGGCTACATGCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.90% 20.60% 0.42% 0.08% NA
All Indica  2759 91.40% 8.30% 0.22% 0.11% NA
All Japonica  1512 69.70% 29.60% 0.66% 0.00% NA
Aus  269 31.20% 68.40% 0.37% 0.00% NA
Indica I  595 97.30% 2.50% 0.17% 0.00% NA
Indica II  465 95.10% 4.70% 0.22% 0.00% NA
Indica III  913 91.60% 8.30% 0.00% 0.11% NA
Indica Intermediate  786 84.60% 14.60% 0.51% 0.25% NA
Temperate Japonica  767 54.50% 44.70% 0.78% 0.00% NA
Tropical Japonica  504 90.50% 9.10% 0.40% 0.00% NA
Japonica Intermediate  241 74.70% 24.50% 0.83% 0.00% NA
VI/Aromatic  96 3.10% 95.80% 1.04% 0.00% NA
Intermediate  90 73.30% 23.30% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0429843384 C -> DEL N N silent_mutation Average:69.279; most accessible tissue: Minghui63 root, score: 97.073 N N N N
vg0429843384 C -> T LOC_Os04g50030-LOC_Os04g50040 intergenic_region ; MODIFIER silent_mutation Average:69.279; most accessible tissue: Minghui63 root, score: 97.073 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0429843384 C T -0.01 -0.04 0.02 0.03 0.07 0.09

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0429843384 NA 5.96E-08 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429843384 NA 1.20E-09 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429843384 NA 5.46E-12 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429843384 NA 3.33E-09 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429843384 NA 6.77E-07 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429843384 NA 2.69E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429843384 NA 4.85E-08 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429843384 NA 1.17E-06 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429843384 NA 4.08E-07 mr1250_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429843384 NA 7.51E-09 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429843384 NA 9.92E-06 mr1726_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251