Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0429812608:

Variant ID: vg0429812608 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 29812608
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.89, A: 0.12, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

GTGATCTGGTCCCAGCCCGGCCGCTGATCGTGTTAGCTTGTGTTCGTACGCACGCGTGTATGCTGTGTGCACATGCGTGTGCTGGAATAAAAAGTGTCAG[A/T]
TGTAAAATTAACATGCTTGATGTAGTTCTGTTCAATGAAAGGGCTTTCGTTTTCATGTGTTTTTGAAGTACGCATCTACGGATCTACTTATATCGATGAA

Reverse complement sequence

TTCATCGATATAAGTAGATCCGTAGATGCGTACTTCAAAAACACATGAAAACGAAAGCCCTTTCATTGAACAGAACTACATCAAGCATGTTAATTTTACA[T/A]
CTGACACTTTTTATTCCAGCACACGCATGTGCACACAGCATACACGCGTGCGTACGAACACAAGCTAACACGATCAGCGGCCGGGCTGGGACCAGATCAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.40%	47.80%	1.18%	0.55%	NA
All Indica	2759	44.40%	52.70%	1.96%	0.94%	NA
All Japonica	1512	69.20%	30.80%	0.07%	0.00%	NA
Aus	269	24.20%	75.50%	0.37%	0.00%	NA
Indica I	595	67.40%	23.90%	7.06%	1.68%	NA
Indica II	465	14.40%	84.50%	0.65%	0.43%	NA
Indica III	913	46.10%	53.50%	0.00%	0.44%	NA
Indica Intermediate	786	42.70%	54.80%	1.15%	1.27%	NA
Temperate Japonica	767	52.70%	47.20%	0.13%	0.00%	NA
Tropical Japonica	504	93.30%	6.70%	0.00%	0.00%	NA
Japonica Intermediate	241	71.40%	28.60%	0.00%	0.00%	NA
VI/Aromatic	96	4.20%	95.80%	0.00%	0.00%	NA
Intermediate	90	48.90%	51.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0429812608	A -> DEL	N	N	silent_mutation	Average:82.051; most accessible tissue: Zhenshan97 flower, score: 93.998	N	N	N	N
vg0429812608	A -> T	LOC_Os04g49980.1	3_prime_UTR_variant ; 172.0bp to feature; MODIFIER	silent_mutation	Average:82.051; most accessible tissue: Zhenshan97 flower, score: 93.998	N	N	N	N
vg0429812608	A -> T	LOC_Os04g49970.1	downstream_gene_variant ; 1800.0bp to feature; MODIFIER	silent_mutation	Average:82.051; most accessible tissue: Zhenshan97 flower, score: 93.998	N	N	N	N
vg0429812608	A -> T	LOC_Os04g49990.1	downstream_gene_variant ; 1425.0bp to feature; MODIFIER	silent_mutation	Average:82.051; most accessible tissue: Zhenshan97 flower, score: 93.998	N	N	N	N
vg0429812608	A -> T	LOC_Os04g49990.2	downstream_gene_variant ; 1425.0bp to feature; MODIFIER	silent_mutation	Average:82.051; most accessible tissue: Zhenshan97 flower, score: 93.998	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0429812608	A	T	0.02	0.0	0.0	0.0	0.01	0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0429812608	NA	7.29E-06	mr1138	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429812608	NA	3.92E-08	mr1169	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429812608	NA	1.06E-11	mr1174	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429812608	NA	1.78E-09	mr1347	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429812608	NA	7.13E-09	mr1406	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429812608	NA	1.95E-08	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429812608	6.80E-06	1.36E-15	mr1174_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429812608	NA	1.50E-06	mr1243_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429812608	NA	7.82E-16	mr1347_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429812608	3.94E-06	2.05E-06	mr1406_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429812608	NA	2.24E-08	mr1406_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429812608	NA	3.22E-07	mr1539_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429812608	NA	3.54E-08	mr1540_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429812608	NA	4.37E-08	mr1732_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429812608	NA	5.34E-06	mr1781_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251