\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0429753312:

Variant ID: vg0429753312 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 29753312
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


TAACACCAATCGGGACTAAAGATCTATTTTTAGTCCCGATTGGTAACACTAACCGGGAAAAAAGATGCCTACTATCTTTAGTTCCGGTTGGTGTTACTAA[C/T]
CGAGACTAAAGATCTATTTTTAGTCACGGTTGGTAATACCAACCGGAACAAAAGATTGTGGCGGAGAGTACGAGGCATCTGCCATCTGAGAGATCGAGGA

Reverse complement sequence

TCCTCGATCTCTCAGATGGCAGATGCCTCGTACTCTCCGCCACAATCTTTTGTTCCGGTTGGTATTACCAACCGTGACTAAAAATAGATCTTTAGTCTCG[G/A]
TTAGTAACACCAACCGGAACTAAAGATAGTAGGCATCTTTTTTCCCGGTTAGTGTTACCAATCGGGACTAAAAATAGATCTTTAGTCCCGATTGGTGTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.80% 7.00% 8.15% 0.06% NA
All Indica  2759 74.60% 11.60% 13.74% 0.11% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 81.80% 5.90% 12.10% 0.17% NA
Indica II  465 37.20% 27.50% 35.05% 0.22% NA
Indica III  913 85.70% 8.50% 5.70% 0.11% NA
Indica Intermediate  786 78.20% 10.10% 11.70% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 83.30% 11.10% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0429753312 C -> DEL N N silent_mutation Average:48.934; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N
vg0429753312 C -> T LOC_Os04g49900.1 upstream_gene_variant ; 1626.0bp to feature; MODIFIER silent_mutation Average:48.934; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N
vg0429753312 C -> T LOC_Os04g49890.1 downstream_gene_variant ; 3075.0bp to feature; MODIFIER silent_mutation Average:48.934; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N
vg0429753312 C -> T LOC_Os04g49890-LOC_Os04g49900 intergenic_region ; MODIFIER silent_mutation Average:48.934; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0429753312 NA 7.16E-12 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429753312 NA 8.46E-07 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429753312 3.16E-07 6.05E-21 mr1169 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429753312 2.00E-06 1.08E-12 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429753312 7.90E-10 1.19E-23 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429753312 1.54E-11 2.30E-21 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429753312 1.57E-07 4.19E-12 mr1347 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429753312 2.97E-07 3.07E-12 mr1347 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429753312 NA 5.65E-09 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429753312 NA 8.05E-09 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429753312 4.24E-06 7.92E-06 mr1406 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429753312 NA 3.49E-08 mr1406 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429753312 NA 2.87E-06 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429753312 NA 1.02E-11 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429753312 NA 3.48E-06 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429753312 NA 6.96E-06 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429753312 1.25E-10 3.78E-27 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429753312 1.78E-13 2.76E-26 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429753312 2.16E-12 7.81E-23 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429753312 3.41E-13 2.30E-24 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429753312 NA 2.50E-09 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429753312 NA 1.94E-09 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429753312 1.20E-07 1.71E-08 mr1406_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429753312 2.23E-08 2.65E-11 mr1406_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429753312 NA 1.10E-06 mr1539_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429753312 NA 5.20E-08 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429753312 NA 2.40E-08 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251