Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0429738953:

Variant ID: vg0429738953 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 29738953
Reference Allele: AAlternative Allele: C,AGTTGCC
Primary Allele: ASecondary Allele: AGTTGCC

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


ATGGCAGTAAAAATGGCGCGTGGCAGCAGCTCAGCTCACGAGGAGATCGGTCTGATTCTGATGGACTGATACGACGAATTTCTGATACAGTTGCAGTTGC[A/C,AGTTGCC]
GTTGCAGGCTTGCCGCTGTCCCGCTCCCGCGTGCTTCAATCCGACCCCAACCCTATGTGCACTTTCGCTCACGTAGGTATCCGCGCCGGAGAAAGGGACG

Reverse complement sequence

CGTCCCTTTCTCCGGCGCGGATACCTACGTGAGCGAAAGTGCACATAGGGTTGGGGTCGGATTGAAGCACGCGGGAGCGGGACAGCGGCAAGCCTGCAAC[T/G,GGCAACT]
GCAACTGCAACTGTATCAGAAATTCGTCGTATCAGTCCATCAGAATCAGACCGATCTCCTCGTGAGCTGAGCTGCTGCCACGCGCCATTTTTACTGCCAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of AGTTGCC(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 99.20% 0.70% 0.00% 0.00% C: 0.06%
All Indica  2759 98.70% 1.20% 0.00% 0.00% C: 0.07%
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 98.90% 0.70% 0.00% 0.00% C: 0.37%
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 97.30% 2.70% 0.00% 0.00% NA
Indica Intermediate  786 98.70% 1.00% 0.00% 0.00% C: 0.25%
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0429738953 A -> C LOC_Os04g49890.1 upstream_gene_variant ; 3358.0bp to feature; MODIFIER silent_mutation Average:96.835; most accessible tissue: Minghui63 flag leaf, score: 98.493 N N N N
vg0429738953 A -> C LOC_Os04g49880.1 downstream_gene_variant ; 1098.0bp to feature; MODIFIER silent_mutation Average:96.835; most accessible tissue: Minghui63 flag leaf, score: 98.493 N N N N
vg0429738953 A -> C LOC_Os04g49870-LOC_Os04g49880 intergenic_region ; MODIFIER silent_mutation Average:96.835; most accessible tissue: Minghui63 flag leaf, score: 98.493 N N N N
vg0429738953 A -> AGTTGCC LOC_Os04g49890.1 upstream_gene_variant ; 3357.0bp to feature; MODIFIER silent_mutation Average:96.835; most accessible tissue: Minghui63 flag leaf, score: 98.493 N N N N
vg0429738953 A -> AGTTGCC LOC_Os04g49880.1 downstream_gene_variant ; 1097.0bp to feature; MODIFIER silent_mutation Average:96.835; most accessible tissue: Minghui63 flag leaf, score: 98.493 N N N N
vg0429738953 A -> AGTTGCC LOC_Os04g49870-LOC_Os04g49880 intergenic_region ; MODIFIER silent_mutation Average:96.835; most accessible tissue: Minghui63 flag leaf, score: 98.493 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0429738953 A AGTTG* -0.36 -0.29 0.06 -0.3 -0.33 -0.29
vg0429738953 A C -0.03 -0.04 -0.03 -0.02 -0.04 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0429738953 NA 6.82E-06 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429738953 NA 1.92E-07 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429738953 NA 6.71E-11 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429738953 5.22E-06 1.99E-14 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429738953 4.43E-06 1.38E-09 mr1531 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429738953 NA 7.47E-10 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429738953 NA 1.03E-09 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251