\
| Variant ID: vg0429681265 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 29681265 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ATTTCTGTTTCTATCTTAACTAGTTCTATTTCTATTTCGTTACTATTCATTCTAATCAACTAGTTTGACTTCTACAGTATTTCATTATTATACATTCCCC[T/C]
GTGTATAATAATTAATTTGTGCCTTTGTAATAATGATTAGATAACATCTATGATTTATGAGAACAACTAAAAATGTTTTTTATTTGCTAAAATATCATTT
AAATGATATTTTAGCAAATAAAAAACATTTTTAGTTGTTCTCATAAATCATAGATGTTATCTAATCATTATTACAAAGGCACAAATTAATTATTATACAC[A/G]
GGGGAATGTATAATAATGAAATACTGTAGAAGTCAAACTAGTTGATTAGAATGAATAGTAACGAAATAGAAATAGAACTAGTTAAGATAGAAACAGAAAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.20% | 40.00% | 2.39% | 6.39% | NA |
| All Indica | 2759 | 21.80% | 67.50% | 3.70% | 7.00% | NA |
| All Japonica | 1512 | 96.60% | 0.10% | 0.40% | 2.84% | NA |
| Aus | 269 | 72.10% | 3.00% | 1.12% | 23.79% | NA |
| Indica I | 595 | 16.00% | 77.10% | 2.86% | 4.03% | NA |
| Indica II | 465 | 18.10% | 68.20% | 1.51% | 12.26% | NA |
| Indica III | 913 | 25.50% | 63.60% | 5.59% | 5.26% | NA |
| Indica Intermediate | 786 | 24.00% | 64.40% | 3.44% | 8.14% | NA |
| Temperate Japonica | 767 | 99.30% | 0.30% | 0.00% | 0.39% | NA |
| Tropical Japonica | 504 | 91.50% | 0.00% | 1.19% | 7.34% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.00% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 17.80% | 2.22% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0429681265 | T -> C | LOC_Os04g49780.1 | upstream_gene_variant ; 700.0bp to feature; MODIFIER | silent_mutation | Average:51.585; most accessible tissue: Callus, score: 98.046 | N | N | N | N |
| vg0429681265 | T -> C | LOC_Os04g49790.1 | downstream_gene_variant ; 1209.0bp to feature; MODIFIER | silent_mutation | Average:51.585; most accessible tissue: Callus, score: 98.046 | N | N | N | N |
| vg0429681265 | T -> C | LOC_Os04g49780-LOC_Os04g49790 | intergenic_region ; MODIFIER | silent_mutation | Average:51.585; most accessible tissue: Callus, score: 98.046 | N | N | N | N |
| vg0429681265 | T -> DEL | N | N | silent_mutation | Average:51.585; most accessible tissue: Callus, score: 98.046 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0429681265 | 4.43E-06 | NA | mr1022 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429681265 | 3.43E-06 | NA | mr1022 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429681265 | NA | 7.71E-33 | mr1161 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429681265 | NA | 3.37E-10 | mr1023_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429681265 | 5.53E-06 | NA | mr1178_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |