\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0429681265:

Variant ID: vg0429681265 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 29681265
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTTCTGTTTCTATCTTAACTAGTTCTATTTCTATTTCGTTACTATTCATTCTAATCAACTAGTTTGACTTCTACAGTATTTCATTATTATACATTCCCC[T/C]
GTGTATAATAATTAATTTGTGCCTTTGTAATAATGATTAGATAACATCTATGATTTATGAGAACAACTAAAAATGTTTTTTATTTGCTAAAATATCATTT

Reverse complement sequence

AAATGATATTTTAGCAAATAAAAAACATTTTTAGTTGTTCTCATAAATCATAGATGTTATCTAATCATTATTACAAAGGCACAAATTAATTATTATACAC[A/G]
GGGGAATGTATAATAATGAAATACTGTAGAAGTCAAACTAGTTGATTAGAATGAATAGTAACGAAATAGAAATAGAACTAGTTAAGATAGAAACAGAAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.20% 40.00% 2.39% 6.39% NA
All Indica  2759 21.80% 67.50% 3.70% 7.00% NA
All Japonica  1512 96.60% 0.10% 0.40% 2.84% NA
Aus  269 72.10% 3.00% 1.12% 23.79% NA
Indica I  595 16.00% 77.10% 2.86% 4.03% NA
Indica II  465 18.10% 68.20% 1.51% 12.26% NA
Indica III  913 25.50% 63.60% 5.59% 5.26% NA
Indica Intermediate  786 24.00% 64.40% 3.44% 8.14% NA
Temperate Japonica  767 99.30% 0.30% 0.00% 0.39% NA
Tropical Japonica  504 91.50% 0.00% 1.19% 7.34% NA
Japonica Intermediate  241 98.80% 0.00% 0.00% 1.24% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 77.80% 17.80% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0429681265 T -> C LOC_Os04g49780.1 upstream_gene_variant ; 700.0bp to feature; MODIFIER silent_mutation Average:51.585; most accessible tissue: Callus, score: 98.046 N N N N
vg0429681265 T -> C LOC_Os04g49790.1 downstream_gene_variant ; 1209.0bp to feature; MODIFIER silent_mutation Average:51.585; most accessible tissue: Callus, score: 98.046 N N N N
vg0429681265 T -> C LOC_Os04g49780-LOC_Os04g49790 intergenic_region ; MODIFIER silent_mutation Average:51.585; most accessible tissue: Callus, score: 98.046 N N N N
vg0429681265 T -> DEL N N silent_mutation Average:51.585; most accessible tissue: Callus, score: 98.046 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0429681265 4.43E-06 NA mr1022 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429681265 3.43E-06 NA mr1022 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429681265 NA 7.71E-33 mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429681265 NA 3.37E-10 mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429681265 5.53E-06 NA mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251