\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0429608547:

Variant ID: vg0429608547 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 29608547
Reference Allele: ACTAlternative Allele: TCT,A
Primary Allele: ACTSecondary Allele: TCT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGTATAAATAAGCTATTAGATTGACTATAGATTAATTGGAGCTATTAGTTGGCTATACTATTAAACTTGCTCTAACAGTAGCCAACTTCGCCACAGCAAC[ACT/TCT,A]
CTCTCTCTCTCTCGCGAGCCGTGCCTGCATCATTGTTCCATGCAGGCGCAGGCCGTGTGTGAGTAGCATATGCACCACATGGTTCACCGCGACTTCGCTA

Reverse complement sequence

TAGCGAAGTCGCGGTGAACCATGTGGTGCATATGCTACTCACACACGGCCTGCGCCTGCATGGAACAATGATGCAGGCACGGCTCGCGAGAGAGAGAGAG[AGT/AGA,T]
GTTGCTGTGGCGAAGTTGGCTACTGTTAGAGCAAGTTTAATAGTATAGCCAACTAATAGCTCCAATTAATCTATAGTCAATCTAATAGCTTATTTATACA

Allele Frequencies:

Populations Population SizeFrequency of ACT(primary allele) Frequency of TCT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.70% 19.10% 3.22% 6.58% A: 0.49%
All Indica  2759 92.90% 3.10% 1.16% 2.75% A: 0.11%
All Japonica  1512 34.50% 51.20% 7.34% 5.95% A: 1.06%
Aus  269 60.60% 1.90% 0.37% 37.17% NA
Indica I  595 97.30% 1.70% 0.84% 0.17% NA
Indica II  465 98.30% 1.10% 0.22% 0.22% A: 0.22%
Indica III  913 86.90% 4.90% 1.64% 6.57% NA
Indica Intermediate  786 93.40% 3.20% 1.40% 1.78% A: 0.25%
Temperate Japonica  767 28.60% 62.70% 6.91% 1.83% NA
Tropical Japonica  504 52.80% 22.60% 10.12% 11.71% A: 2.78%
Japonica Intermediate  241 14.90% 74.30% 2.90% 7.05% A: 0.83%
VI/Aromatic  96 39.60% 20.80% 1.04% 37.50% A: 1.04%
Intermediate  90 60.00% 18.90% 7.78% 10.00% A: 3.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0429608547 ACT -> TCT LOC_Os04g49650.1 upstream_gene_variant ; 1382.0bp to feature; MODIFIER silent_mutation Average:96.685; most accessible tissue: Minghui63 flower, score: 98.177 N N N N
vg0429608547 ACT -> TCT LOC_Os04g49650.2 upstream_gene_variant ; 1373.0bp to feature; MODIFIER silent_mutation Average:96.685; most accessible tissue: Minghui63 flower, score: 98.177 N N N N
vg0429608547 ACT -> TCT LOC_Os04g49660.1 downstream_gene_variant ; 1607.0bp to feature; MODIFIER silent_mutation Average:96.685; most accessible tissue: Minghui63 flower, score: 98.177 N N N N
vg0429608547 ACT -> TCT LOC_Os04g49650-LOC_Os04g49660 intergenic_region ; MODIFIER silent_mutation Average:96.685; most accessible tissue: Minghui63 flower, score: 98.177 N N N N
vg0429608547 ACT -> DEL N N silent_mutation Average:96.685; most accessible tissue: Minghui63 flower, score: 98.177 N N N N
vg0429608547 ACT -> A LOC_Os04g49650.1 upstream_gene_variant ; 1383.0bp to feature; MODIFIER silent_mutation Average:96.685; most accessible tissue: Minghui63 flower, score: 98.177 N N N N
vg0429608547 ACT -> A LOC_Os04g49650.2 upstream_gene_variant ; 1374.0bp to feature; MODIFIER silent_mutation Average:96.685; most accessible tissue: Minghui63 flower, score: 98.177 N N N N
vg0429608547 ACT -> A LOC_Os04g49660.1 downstream_gene_variant ; 1606.0bp to feature; MODIFIER silent_mutation Average:96.685; most accessible tissue: Minghui63 flower, score: 98.177 N N N N
vg0429608547 ACT -> A LOC_Os04g49650-LOC_Os04g49660 intergenic_region ; MODIFIER silent_mutation Average:96.685; most accessible tissue: Minghui63 flower, score: 98.177 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0429608547 ACT A 0.0 0.26 0.23 -0.01 0.07 0.1
vg0429608547 ACT TCT 0.05 0.05 0.02 -0.04 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0429608547 NA 4.62E-07 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429608547 NA 2.66E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429608547 4.01E-06 4.01E-06 mr1877 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429608547 NA 8.09E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251