\
| Variant ID: vg0429377757 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 29377757 |
| Reference Allele: G | Alternative Allele: T,A |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATATATATAGAAAAACTATTCTACACCCAAGCGGGTATAGAATAGCTATTCTATACCCCCTCTCTCCCAAGGGTCAAACCCACCTCCCACCTTAGTCAAA[G/T,A]
GTCAGTCAAAGCATCCCCACGTTGGTTAAAGCCCGGTCAAATCATCTACCAACTCCCCCCAAAAACCAATTCTTCTCATCTTTCGTCTTGCACGAACTCG
CGAGTTCGTGCAAGACGAAAGATGAGAAGAATTGGTTTTTGGGGGGAGTTGGTAGATGATTTGACCGGGCTTTAACCAACGTGGGGATGCTTTGACTGAC[C/A,T]
TTTGACTAAGGTGGGAGGTGGGTTTGACCCTTGGGAGAGAGGGGGTATAGAATAGCTATTCTATACCCGCTTGGGTGTAGAATAGTTTTTCTATATATAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.60% | 12.90% | 0.47% | 0.00% | A: 0.04% |
| All Indica | 2759 | 95.90% | 4.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 67.00% | 31.70% | 1.26% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 89.50% | 10.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 97.50% | 1.30% | 1.17% | 0.00% | NA |
| Tropical Japonica | 504 | 22.80% | 77.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 62.20% | 34.00% | 3.73% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 17.80% | 2.22% | 0.00% | A: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0429377757 | G -> A | LOC_Os04g49230-LOC_Os04g49240 | intergenic_region ; MODIFIER | silent_mutation | Average:47.828; most accessible tissue: Minghui63 root, score: 80.163 | N | N | N | N |
| vg0429377757 | G -> T | LOC_Os04g49230-LOC_Os04g49240 | intergenic_region ; MODIFIER | silent_mutation | Average:47.828; most accessible tissue: Minghui63 root, score: 80.163 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0429377757 | NA | 1.69E-07 | mr1194 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429377757 | NA | 1.25E-07 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429377757 | NA | 2.40E-06 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429377757 | NA | 5.66E-14 | mr1449 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429377757 | NA | 1.24E-08 | mr1449 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429377757 | NA | 3.87E-07 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429377757 | NA | 1.77E-06 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429377757 | 1.80E-06 | NA | mr1124_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429377757 | NA | 3.68E-06 | mr1194_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429377757 | NA | 3.29E-10 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429377757 | NA | 4.19E-06 | mr1786_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429377757 | 2.10E-06 | NA | mr1850_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |