\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0429234433:

Variant ID: vg0429234433 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 29234433
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


CTCGTCGGTATCATCGAGTTATGCTTTTCCCTTTGTAATCTGTGGTTTCCATTGTATAATCCCATATCAATTGGATTAGGGCTATTACCTATCAAGAAGC[C/T]
TGAACCAGTATAATCTTTGTTTTTTGCCTGCTTGATGTCGTATTACGTAGATCCTTGTATCGTCGTACCCCAATACCCTCTATATCCGGTCTACGGGTAT

Reverse complement sequence

ATACCCGTAGACCGGATATAGAGGGTATTGGGGTACGACGATACAAGGATCTACGTAATACGACATCAAGCAGGCAAAAAACAAAGATTATACTGGTTCA[G/A]
GCTTCTTGATAGGTAATAGCCCTAATCCAATTGATATGGGATTATACAATGGAAACCACAGATTACAAAGGGAAAAGCATAACTCGATGATACCGACGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.40% 10.10% 2.54% 0.00% NA
All Indica  2759 78.80% 17.00% 4.17% 0.00% NA
All Japonica  1512 99.80% 0.10% 0.13% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 88.10% 3.50% 8.40% 0.00% NA
Indica II  465 41.50% 54.40% 4.09% 0.00% NA
Indica III  913 90.30% 7.60% 2.19% 0.00% NA
Indica Intermediate  786 80.70% 16.00% 3.31% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 91.10% 6.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0429234433 C -> T LOC_Os04g49040.1 upstream_gene_variant ; 838.0bp to feature; MODIFIER silent_mutation Average:43.552; most accessible tissue: Zhenshan97 root, score: 60.612 N N N N
vg0429234433 C -> T LOC_Os04g49030.1 downstream_gene_variant ; 4491.0bp to feature; MODIFIER silent_mutation Average:43.552; most accessible tissue: Zhenshan97 root, score: 60.612 N N N N
vg0429234433 C -> T LOC_Os04g49040-LOC_Os04g49050 intergenic_region ; MODIFIER silent_mutation Average:43.552; most accessible tissue: Zhenshan97 root, score: 60.612 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0429234433 NA 3.42E-12 mr1169 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429234433 NA 6.12E-08 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429234433 NA 9.50E-11 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429234433 NA 8.16E-08 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429234433 NA 1.09E-07 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429234433 NA 7.00E-15 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429234433 NA 9.38E-12 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429234433 NA 3.62E-12 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429234433 NA 1.35E-10 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429234433 NA 2.38E-06 mr1539_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429234433 NA 4.30E-06 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429234433 NA 8.58E-07 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429234433 2.57E-06 2.56E-06 mr1848_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251