Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0429127308:

Variant ID: vg0429127308 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 29127308
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.84, T: 0.17, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


CTAATTATAAATATTTAATATAGACTATTAATAAAATCTATTCATAATCTTGAACTAATTCGTGAGACGAATCTATTGAGCCTAATTAATCCATGATTAG[T/C]
CTATGTGATGCTACAGTAAATATTCTCTAATTATAAATTAATTAGGCTTAAAAAGGTTATCTTACAAATTAGCTTTCATTTATGTAATTAGTTTTATAAG

Reverse complement sequence

CTTATAAAACTAATTACATAAATGAAAGCTAATTTGTAAGATAACCTTTTTAAGCCTAATTAATTTATAATTAGAGAATATTTACTGTAGCATCACATAG[A/G]
CTAATCATGGATTAATTAGGCTCAATAGATTCGTCTCACGAATTAGTTCAAGATTATGAATAGATTTTATTAATAGTCTATATTAAATATTTATAATTAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.20% 16.70% 0.06% 0.00% NA
All Indica  2759 96.90% 3.00% 0.04% 0.00% NA
All Japonica  1512 68.30% 31.70% 0.00% 0.00% NA
Aus  269 53.20% 46.80% 0.00% 0.00% NA
Indica I  595 98.20% 1.80% 0.00% 0.00% NA
Indica II  465 97.00% 3.00% 0.00% 0.00% NA
Indica III  913 98.70% 1.30% 0.00% 0.00% NA
Indica Intermediate  786 93.90% 6.00% 0.13% 0.00% NA
Temperate Japonica  767 84.10% 15.90% 0.00% 0.00% NA
Tropical Japonica  504 59.90% 40.10% 0.00% 0.00% NA
Japonica Intermediate  241 35.30% 64.70% 0.00% 0.00% NA
VI/Aromatic  96 18.80% 81.20% 0.00% 0.00% NA
Intermediate  90 74.40% 23.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0429127308 T -> C LOC_Os04g48840.1 upstream_gene_variant ; 324.0bp to feature; MODIFIER silent_mutation Average:90.095; most accessible tissue: Minghui63 young leaf, score: 96.449 N N N N
vg0429127308 T -> C LOC_Os04g48830.1 downstream_gene_variant ; 4141.0bp to feature; MODIFIER silent_mutation Average:90.095; most accessible tissue: Minghui63 young leaf, score: 96.449 N N N N
vg0429127308 T -> C LOC_Os04g48850.1 downstream_gene_variant ; 4502.0bp to feature; MODIFIER silent_mutation Average:90.095; most accessible tissue: Minghui63 young leaf, score: 96.449 N N N N
vg0429127308 T -> C LOC_Os04g48840-LOC_Os04g48850 intergenic_region ; MODIFIER silent_mutation Average:90.095; most accessible tissue: Minghui63 young leaf, score: 96.449 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0429127308 T C -0.01 -0.01 0.0 0.01 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0429127308 NA 7.58E-08 mr1733 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429127308 NA 1.05E-06 mr1318_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429127308 NA 6.98E-07 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429127308 NA 1.76E-08 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251