\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0429090551:

Variant ID: vg0429090551 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 29090551
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


CTCACACACACAAACAATTCAAACCGCATGCCACTGACATTATATTTTATCATCATCAATGCAGTAATTATGCCACCATCTGCTCTTGATCGGCTTGGTA[A/G]
GCTCAATCTCAGCTCTTTTATACTCTGGCCTTAGATTTACATTAATTGTTTTGGCTCCTCTAACAGCTTCTCTGCACATTGAATATCCTATGCTGTTTGA

Reverse complement sequence

TCAAACAGCATAGGATATTCAATGTGCAGAGAAGCTGTTAGAGGAGCCAAAACAATTAATGTAAATCTAAGGCCAGAGTATAAAAGAGCTGAGATTGAGC[T/C]
TACCAAGCCGATCAAGAGCAGATGGTGGCATAATTACTGCATTGATGATGATAAAATATAATGTCAGTGGCATGCGGTTTGAATTGTTTGTGTGTGTGAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.50% 16.40% 0.17% 0.00% NA
All Indica  2759 96.70% 3.10% 0.14% 0.00% NA
All Japonica  1512 68.30% 31.60% 0.13% 0.00% NA
Aus  269 58.70% 41.30% 0.00% 0.00% NA
Indica I  595 98.00% 1.80% 0.17% 0.00% NA
Indica II  465 96.60% 3.20% 0.22% 0.00% NA
Indica III  913 98.60% 1.30% 0.11% 0.00% NA
Indica Intermediate  786 93.80% 6.10% 0.13% 0.00% NA
Temperate Japonica  767 83.80% 16.20% 0.00% 0.00% NA
Tropical Japonica  504 60.10% 39.70% 0.20% 0.00% NA
Japonica Intermediate  241 35.70% 63.90% 0.41% 0.00% NA
VI/Aromatic  96 16.70% 82.30% 1.04% 0.00% NA
Intermediate  90 76.70% 22.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0429090551 A -> G LOC_Os04g48770.2 5_prime_UTR_variant ; 90.0bp to feature; MODIFIER silent_mutation Average:54.086; most accessible tissue: Zhenshan97 young leaf, score: 75.397 N N N N
vg0429090551 A -> G LOC_Os04g48760.1 downstream_gene_variant ; 3756.0bp to feature; MODIFIER silent_mutation Average:54.086; most accessible tissue: Zhenshan97 young leaf, score: 75.397 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0429090551 NA 7.54E-07 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429090551 NA 2.05E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429090551 NA 7.03E-07 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429090551 NA 8.41E-06 mr1318_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429090551 NA 6.34E-08 mr1318_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429090551 NA 1.79E-07 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429090551 NA 1.71E-06 mr1531_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429090551 NA 2.06E-06 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429090551 NA 2.40E-06 mr1702_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429090551 NA 1.87E-06 mr1729_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429090551 NA 6.10E-07 mr1788_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429090551 NA 1.40E-09 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429090551 NA 1.95E-06 mr1974_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251