Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0429090551:

Variant ID: vg0429090551 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 29090551
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:

CTCACACACACAAACAATTCAAACCGCATGCCACTGACATTATATTTTATCATCATCAATGCAGTAATTATGCCACCATCTGCTCTTGATCGGCTTGGTA[A/G]
GCTCAATCTCAGCTCTTTTATACTCTGGCCTTAGATTTACATTAATTGTTTTGGCTCCTCTAACAGCTTCTCTGCACATTGAATATCCTATGCTGTTTGA

Reverse complement sequence

TCAAACAGCATAGGATATTCAATGTGCAGAGAAGCTGTTAGAGGAGCCAAAACAATTAATGTAAATCTAAGGCCAGAGTATAAAAGAGCTGAGATTGAGC[T/C]
TACCAAGCCGATCAAGAGCAGATGGTGGCATAATTACTGCATTGATGATGATAAAATATAATGTCAGTGGCATGCGGTTTGAATTGTTTGTGTGTGTGAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.50%	16.40%	0.17%	0.00%	NA
All Indica	2759	96.70%	3.10%	0.14%	0.00%	NA
All Japonica	1512	68.30%	31.60%	0.13%	0.00%	NA
Aus	269	58.70%	41.30%	0.00%	0.00%	NA
Indica I	595	98.00%	1.80%	0.17%	0.00%	NA
Indica II	465	96.60%	3.20%	0.22%	0.00%	NA
Indica III	913	98.60%	1.30%	0.11%	0.00%	NA
Indica Intermediate	786	93.80%	6.10%	0.13%	0.00%	NA
Temperate Japonica	767	83.80%	16.20%	0.00%	0.00%	NA
Tropical Japonica	504	60.10%	39.70%	0.20%	0.00%	NA
Japonica Intermediate	241	35.70%	63.90%	0.41%	0.00%	NA
VI/Aromatic	96	16.70%	82.30%	1.04%	0.00%	NA
Intermediate	90	76.70%	22.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0429090551	A -> G	LOC_Os04g48770.2	5_prime_UTR_variant ; 90.0bp to feature; MODIFIER	silent_mutation	Average:54.086; most accessible tissue: Zhenshan97 young leaf, score: 75.397	N	N	N	N
vg0429090551	A -> G	LOC_Os04g48760.1	downstream_gene_variant ; 3756.0bp to feature; MODIFIER	silent_mutation	Average:54.086; most accessible tissue: Zhenshan97 young leaf, score: 75.397	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0429090551	NA	7.54E-07	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429090551	NA	2.05E-06	mr1788	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429090551	NA	7.03E-07	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429090551	NA	8.41E-06	mr1318_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429090551	NA	6.34E-08	mr1318_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429090551	NA	1.79E-07	mr1521_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429090551	NA	1.71E-06	mr1531_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429090551	NA	2.06E-06	mr1680_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429090551	NA	2.40E-06	mr1702_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429090551	NA	1.87E-06	mr1729_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429090551	NA	6.10E-07	mr1788_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429090551	NA	1.40E-09	mr1788_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429090551	NA	1.95E-06	mr1974_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251