\
| Variant ID: vg0428960374 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 28960374 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGCAAAGAGATTAGATGCAACTTCATCTTGTGCTTCCAAGCGGCATAATGTGTCCCATCAAAATGAGGTGCACGCCCGGAAGGCACGGAGACAAAGTTAT[G/T]
AGGAGGAACATTAAGTTTGATGTAATCAAAGTGAATAGTAGCTCCCTTTGATCCAGTCTCCTTGGTGCTAGAAGCGTCTCCCTTCTCCTCCAAATATTCG
CGAATATTTGGAGGAGAAGGGAGACGCTTCTAGCACCAAGGAGACTGGATCAAAGGGAGCTACTATTCACTTTGATTACATCAAACTTAATGTTCCTCCT[C/A]
ATAACTTTGTCTCCGTGCCTTCCGGGCGTGCACCTCATTTTGATGGGACACATTATGCCGCTTGGAAGCACAAGATGAAGTTGCATCTAATCTCTTTGCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.50% | 1.60% | 12.17% | 33.75% | NA |
| All Indica | 2759 | 22.70% | 2.60% | 18.96% | 55.74% | NA |
| All Japonica | 1512 | 99.60% | 0.00% | 0.07% | 0.33% | NA |
| Aus | 269 | 71.00% | 1.90% | 16.36% | 10.78% | NA |
| Indica I | 595 | 10.30% | 2.20% | 11.26% | 76.30% | NA |
| Indica II | 465 | 10.80% | 1.50% | 12.26% | 75.48% | NA |
| Indica III | 913 | 37.50% | 2.80% | 26.51% | 33.19% | NA |
| Indica Intermediate | 786 | 22.10% | 3.20% | 19.97% | 54.71% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 99.40% | 0.00% | 0.20% | 0.40% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 68.90% | 1.10% | 7.78% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0428960374 | G -> DEL | LOC_Os04g48590.1 | N | frameshift_variant | Average:14.581; most accessible tissue: Callus, score: 20.623 | N | N | N | N |
| vg0428960374 | G -> T | LOC_Os04g48590.1 | missense_variant ; p.His41Asn; MODERATE | nonsynonymous_codon ; H41N | Average:14.581; most accessible tissue: Callus, score: 20.623 | benign |
1.278 |
TOLERATED | 0.06 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0428960374 | NA | 2.34E-23 | mr1083 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428960374 | NA | 9.97E-06 | mr1104 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428960374 | NA | 1.75E-13 | mr1169 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428960374 | NA | 1.26E-27 | mr1181 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428960374 | NA | 4.34E-06 | mr1181 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428960374 | 1.78E-06 | 1.24E-13 | mr1195 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428960374 | 6.15E-06 | 3.00E-06 | mr1448 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428960374 | NA | 4.77E-13 | mr1655 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428960374 | NA | 4.86E-09 | mr1770 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428960374 | NA | 3.64E-07 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428960374 | NA | 3.26E-06 | mr1970 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428960374 | NA | 4.54E-08 | mr1973 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |