\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0428848253:

Variant ID: vg0428848253 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 28848253
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGAAATTCCTACATAAATCCTTTGATTCAAAGGGGCCCTTAAAGTTCATATAAGTGGGTTCCATCTATATAGACTACTTTTGCCATATACATTGTTGTTG[C/T]
CCTTAGAAACTATAGGATGATTCAAAAATAGACGTATGAGAATTGTTCAAAAATGGGCGCATATCTGGCAGTAAAATTTTACTTATCGCGATGTGAATAA

Reverse complement sequence

TTATTCACATCGCGATAAGTAAAATTTTACTGCCAGATATGCGCCCATTTTTGAACAATTCTCATACGTCTATTTTTGAATCATCCTATAGTTTCTAAGG[G/A]
CAACAACAATGTATATGGCAAAAGTAGTCTATATAGATGGAACCCACTTATATGAACTTTAAGGGCCCCTTTGAATCAAAGGATTTATGTAGGAATTTCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.80% 12.00% 6.18% 0.00% NA
All Indica  2759 69.10% 20.40% 10.47% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 25.90% 43.90% 30.25% 0.00% NA
Indica II  465 88.00% 6.20% 5.81% 0.00% NA
Indica III  913 84.70% 14.20% 1.10% 0.00% NA
Indica Intermediate  786 72.60% 18.20% 9.16% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 94.40% 4.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0428848253 C -> T LOC_Os04g48375.1 upstream_gene_variant ; 1014.0bp to feature; MODIFIER silent_mutation Average:31.525; most accessible tissue: Callus, score: 64.408 N N N N
vg0428848253 C -> T LOC_Os04g48370.1 downstream_gene_variant ; 1365.0bp to feature; MODIFIER silent_mutation Average:31.525; most accessible tissue: Callus, score: 64.408 N N N N
vg0428848253 C -> T LOC_Os04g48370-LOC_Os04g48375 intergenic_region ; MODIFIER silent_mutation Average:31.525; most accessible tissue: Callus, score: 64.408 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0428848253 NA 2.60E-07 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428848253 NA 5.97E-15 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428848253 NA 5.45E-08 mr1531 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428848253 NA 3.31E-06 mr1942 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251