Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0428848253:

Variant ID: vg0428848253 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 28848253
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGAAATTCCTACATAAATCCTTTGATTCAAAGGGGCCCTTAAAGTTCATATAAGTGGGTTCCATCTATATAGACTACTTTTGCCATATACATTGTTGTTG[C/T]
CCTTAGAAACTATAGGATGATTCAAAAATAGACGTATGAGAATTGTTCAAAAATGGGCGCATATCTGGCAGTAAAATTTTACTTATCGCGATGTGAATAA

Reverse complement sequence

TTATTCACATCGCGATAAGTAAAATTTTACTGCCAGATATGCGCCCATTTTTGAACAATTCTCATACGTCTATTTTTGAATCATCCTATAGTTTCTAAGG[G/A]
CAACAACAATGTATATGGCAAAAGTAGTCTATATAGATGGAACCCACTTATATGAACTTTAAGGGCCCCTTTGAATCAAAGGATTTATGTAGGAATTTCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.80%	12.00%	6.18%	0.00%	NA
All Indica	2759	69.10%	20.40%	10.47%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	25.90%	43.90%	30.25%	0.00%	NA
Indica II	465	88.00%	6.20%	5.81%	0.00%	NA
Indica III	913	84.70%	14.20%	1.10%	0.00%	NA
Indica Intermediate	786	72.60%	18.20%	9.16%	0.00%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	94.40%	4.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0428848253	C -> T	LOC_Os04g48375.1	upstream_gene_variant ; 1014.0bp to feature; MODIFIER	silent_mutation	Average:31.525; most accessible tissue: Callus, score: 64.408	N	N	N	N
vg0428848253	C -> T	LOC_Os04g48370.1	downstream_gene_variant ; 1365.0bp to feature; MODIFIER	silent_mutation	Average:31.525; most accessible tissue: Callus, score: 64.408	N	N	N	N
vg0428848253	C -> T	LOC_Os04g48370-LOC_Os04g48375	intergenic_region ; MODIFIER	silent_mutation	Average:31.525; most accessible tissue: Callus, score: 64.408	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0428848253	NA	2.60E-07	mr1130	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428848253	NA	5.97E-15	mr1531	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428848253	NA	5.45E-08	mr1531	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428848253	NA	3.31E-06	mr1942	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251