\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0428739520:

Variant ID: vg0428739520 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 28739520
Reference Allele: TAlternative Allele: C,G
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATTTCTTATGGTATGATGCACAATGTATATGGTCTTTAACATGGGTCTCACTATAAAATAAAAAAATTAAGATGGCTGCCAACTTCTTTGAGATAGTAG[T/C,G]
AGGGAGAGAGAGGATGTGTAGGAGAAAAAAATACTTGTTTATTCACTATGGCTAGTTGTAAGCTTGAGTTGCATCATAAGAATTTTTTTCCTATTGCTAA

Reverse complement sequence

TTAGCAATAGGAAAAAAATTCTTATGATGCAACTCAAGCTTACAACTAGCCATAGTGAATAAACAAGTATTTTTTTCTCCTACACATCCTCTCTCTCCCT[A/G,C]
CTACTATCTCAAAGAAGTTGGCAGCCATCTTAATTTTTTTATTTTATAGTGAGACCCATGTTAAAGACCATATACATTGTGCATCATACCATAAGAAATG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.60% 3.80% 0.49% 0.00% G: 0.13%
All Indica  2759 99.80% 0.20% 0.00% 0.00% G: 0.04%
All Japonica  1512 87.70% 10.80% 1.52% 0.00% NA
Aus  269 98.50% 0.00% 0.00% 0.00% G: 1.49%
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.80% 0.10% 0.00% 0.00% G: 0.11%
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 99.50% 0.10% 0.39% 0.00% NA
Tropical Japonica  504 65.90% 31.00% 3.17% 0.00% NA
Japonica Intermediate  241 95.90% 2.50% 1.66% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 0.00% G: 1.04%
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0428739520 T -> C LOC_Os04g48240.1 upstream_gene_variant ; 2771.0bp to feature; MODIFIER silent_mutation Average:69.642; most accessible tissue: Callus, score: 96.267 N N N N
vg0428739520 T -> C LOC_Os04g48260.1 upstream_gene_variant ; 4877.0bp to feature; MODIFIER silent_mutation Average:69.642; most accessible tissue: Callus, score: 96.267 N N N N
vg0428739520 T -> C LOC_Os04g48250.1 downstream_gene_variant ; 382.0bp to feature; MODIFIER silent_mutation Average:69.642; most accessible tissue: Callus, score: 96.267 N N N N
vg0428739520 T -> C LOC_Os04g48240-LOC_Os04g48250 intergenic_region ; MODIFIER silent_mutation Average:69.642; most accessible tissue: Callus, score: 96.267 N N N N
vg0428739520 T -> G LOC_Os04g48240.1 upstream_gene_variant ; 2771.0bp to feature; MODIFIER silent_mutation Average:69.642; most accessible tissue: Callus, score: 96.267 N N N N
vg0428739520 T -> G LOC_Os04g48260.1 upstream_gene_variant ; 4877.0bp to feature; MODIFIER silent_mutation Average:69.642; most accessible tissue: Callus, score: 96.267 N N N N
vg0428739520 T -> G LOC_Os04g48250.1 downstream_gene_variant ; 382.0bp to feature; MODIFIER silent_mutation Average:69.642; most accessible tissue: Callus, score: 96.267 N N N N
vg0428739520 T -> G LOC_Os04g48240-LOC_Os04g48250 intergenic_region ; MODIFIER silent_mutation Average:69.642; most accessible tissue: Callus, score: 96.267 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0428739520 T C -0.06 -0.01 -0.01 -0.03 -0.03 -0.03
vg0428739520 T G -0.06 0.0 0.0 -0.02 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0428739520 1.86E-07 9.01E-09 mr1076 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428739520 NA 3.04E-08 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428739520 1.82E-06 2.22E-09 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428739520 2.66E-06 9.41E-08 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428739520 2.27E-06 1.23E-06 mr1227 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428739520 4.04E-08 7.35E-06 mr1411 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428739520 6.84E-06 6.84E-06 mr1436 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428739520 NA 5.14E-06 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428739520 NA 5.00E-06 mr1949 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428739520 5.85E-06 5.84E-06 mr1076_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428739520 NA 1.04E-07 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428739520 NA 1.18E-06 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428739520 6.81E-06 1.66E-06 mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428739520 NA 1.34E-07 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428739520 NA 7.61E-07 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251