\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0428715266:

Variant ID: vg0428715266 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 28715266
Reference Allele: AAlternative Allele: G,AT
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.01, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


AATTGCTTTGGATCAACTGTCCATGCATTTATTTCTTGCAGCTGACGAACGTCTCAATCGCAGCCCATTAAGTAATTACTACTACATCCGTCATATTATA[A/G,AT]
ATGCGGTTATGGTTTCCATGTCCAACGTTTAACCGTCCGTTTTATTTGAAAAATTTATAATTTTTTTTAAAAAATAGTCACACATAAAATATTATTCATG

Reverse complement sequence

CATGAATAATATTTTATGTGTGACTATTTTTTAAAAAAAATTATAAATTTTTCAAATAAAACGGACGGTTAAACGTTGGACATGGAAACCATAACCGCAT[T/C,AT]
TATAATATGACGGATGTAGTAGTAATTACTTAATGGGCTGCGATTGAGACGTTCGTCAGCTGCAAGAAATAAATGCATGGACAGTTGATCCAAAGCAATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.00% 46.70% 0.23% 0.04% AT: 0.02%
All Indica  2759 87.50% 12.00% 0.36% 0.07% AT: 0.04%
All Japonica  1512 0.20% 99.80% 0.00% 0.00% NA
Aus  269 20.80% 79.20% 0.00% 0.00% NA
Indica I  595 97.30% 2.20% 0.34% 0.17% NA
Indica II  465 93.50% 6.20% 0.22% 0.00% NA
Indica III  913 81.30% 18.30% 0.22% 0.11% AT: 0.11%
Indica Intermediate  786 83.80% 15.50% 0.64% 0.00% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 0.20% 99.80% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 30.00% 68.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0428715266 A -> DEL N N silent_mutation Average:59.51; most accessible tissue: Zhenshan97 root, score: 79.452 N N N N
vg0428715266 A -> G LOC_Os04g48210.1 downstream_gene_variant ; 166.0bp to feature; MODIFIER silent_mutation Average:59.51; most accessible tissue: Zhenshan97 root, score: 79.452 N N N N
vg0428715266 A -> G LOC_Os04g48210.2 downstream_gene_variant ; 166.0bp to feature; MODIFIER silent_mutation Average:59.51; most accessible tissue: Zhenshan97 root, score: 79.452 N N N N
vg0428715266 A -> G LOC_Os04g48200-LOC_Os04g48210 intergenic_region ; MODIFIER silent_mutation Average:59.51; most accessible tissue: Zhenshan97 root, score: 79.452 N N N N
vg0428715266 A -> AT LOC_Os04g48210.1 downstream_gene_variant ; 165.0bp to feature; MODIFIER silent_mutation Average:59.51; most accessible tissue: Zhenshan97 root, score: 79.452 N N N N
vg0428715266 A -> AT LOC_Os04g48210.2 downstream_gene_variant ; 165.0bp to feature; MODIFIER silent_mutation Average:59.51; most accessible tissue: Zhenshan97 root, score: 79.452 N N N N
vg0428715266 A -> AT LOC_Os04g48200-LOC_Os04g48210 intergenic_region ; MODIFIER silent_mutation Average:59.51; most accessible tissue: Zhenshan97 root, score: 79.452 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0428715266 NA 1.92E-25 mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428715266 NA 1.27E-33 mr1104 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428715266 NA 5.60E-06 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428715266 NA 8.93E-46 mr1111 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428715266 NA 4.36E-28 mr1145 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428715266 NA 2.38E-14 mr1169 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428715266 NA 1.88E-27 mr1181 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428715266 NA 6.17E-11 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428715266 NA 7.57E-15 mr1199 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428715266 NA 4.67E-31 mr1204 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428715266 NA 1.59E-29 mr1426 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428715266 NA 6.05E-28 mr1436 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428715266 NA 9.44E-40 mr1437 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428715266 NA 1.32E-41 mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428715266 NA 2.40E-43 mr1509 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428715266 3.75E-06 NA mr1548 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428715266 NA 2.54E-25 mr1551 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428715266 NA 7.12E-30 mr1560 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428715266 NA 8.97E-14 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428715266 NA 2.97E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428715266 NA 3.80E-51 mr1798 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428715266 NA 3.03E-11 mr1883 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428715266 NA 3.09E-69 mr1970 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428715266 NA 1.35E-89 mr1973 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428715266 NA 5.58E-08 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428715266 NA 3.21E-49 mr1111_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428715266 NA 3.76E-18 mr1131_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428715266 NA 7.16E-51 mr1144_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428715266 NA 1.74E-21 mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428715266 NA 2.19E-17 mr1199_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428715266 NA 1.02E-24 mr1244_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428715266 NA 5.38E-44 mr1509_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428715266 NA 4.05E-32 mr1571_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428715266 NA 1.68E-74 mr1798_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428715266 NA 1.03E-67 mr1970_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428715266 NA 1.35E-06 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428715266 NA 2.31E-102 mr1973_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428715266 NA 3.39E-08 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251