\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0428458707:

Variant ID: vg0428458707 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 28458707
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTTTTTAACATTTTTTTCAAACTTTTAATTTTTTTATCCCATTAAAATTTTTCTACACATAAATTTTTAACTTTTTCGTCATAAATTTTTAATTTTGAC[G/A]
TGAACTAAACGCATCCATAACTTGCCACAGGACCAGCAGCCGGCGCACAGCACGATGACATATTTAGGAGAGAGCATTGCGTCGCGCTAGCTACGGGTGA

Reverse complement sequence

TCACCCGTAGCTAGCGCGACGCAATGCTCTCTCCTAAATATGTCATCGTGCTGTGCGCCGGCTGCTGGTCCTGTGGCAAGTTATGGATGCGTTTAGTTCA[C/T]
GTCAAAATTAAAAATTTATGACGAAAAAGTTAAAAATTTATGTGTAGAAAAATTTTAATGGGATAAAAAAATTAAAAGTTTGAAAAAAATGTTAAAAAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.10% 17.00% 5.21% 34.68% NA
All Indica  2759 9.50% 24.10% 8.01% 58.43% NA
All Japonica  1512 99.50% 0.10% 0.07% 0.26% NA
Aus  269 45.00% 48.00% 6.69% 0.37% NA
Indica I  595 7.20% 24.40% 12.61% 55.80% NA
Indica II  465 11.20% 9.50% 7.10% 72.26% NA
Indica III  913 8.10% 28.60% 3.72% 59.58% NA
Indica Intermediate  786 11.70% 27.40% 10.05% 50.89% NA
Temperate Japonica  767 99.70% 0.00% 0.00% 0.26% NA
Tropical Japonica  504 99.20% 0.40% 0.20% 0.20% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 58.90% 10.00% 6.67% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0428458707 G -> DEL N N silent_mutation Average:69.458; most accessible tissue: Callus, score: 89.605 N N N N
vg0428458707 G -> A LOC_Os04g47870-LOC_Os04g47890 intergenic_region ; MODIFIER silent_mutation Average:69.458; most accessible tissue: Callus, score: 89.605 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0428458707 G A -0.02 -0.01 -0.01 0.01 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0428458707 7.58E-06 NA mr1873 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428458707 NA 2.16E-06 mr1562_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428458707 7.04E-07 7.02E-07 mr1752_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428458707 NA 9.66E-06 mr1759_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428458707 NA 4.34E-07 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428458707 1.17E-06 NA mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428458707 NA 6.34E-06 mr1873_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251