Variant ID: vg0428353570 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 28353570 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTGTGAAAACTAAAATGGCCTATATTTATGTGAGGATTTGATCCTTCTATGTGGCATGAGGTAACCCAGACTCGGTTTGGAAAGGCTTTGTCGTGAACCT[C/T]
TGACACCGGCCAGTGTCTGGAGTAAGTTCGTGTCTTGTGGGTAAAGTGTACCCCTCTGCAGAGGTTAACTAACTGTTCGAACAGCCGTGCCCACGGTCAT
ATGACCGTGGGCACGGCTGTTCGAACAGTTAGTTAACCTCTGCAGAGGGGTACACTTTACCCACAAGACACGAACTTACTCCAGACACTGGCCGGTGTCA[G/A]
AGGTTCACGACAAAGCCTTTCCAAACCGAGTCTGGGTTACCTCATGCCACATAGAAGGATCAAATCCTCACATAAATATAGGCCATTTTAGTTTTCACAA
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 56.60% | 43.30% | 0.02% | 0.02% | NA |
All Indica | 2759 | 26.70% | 73.20% | 0.04% | 0.04% | NA |
All Japonica | 1512 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 28.10% | 71.80% | 0.00% | 0.17% | NA |
Indica II | 465 | 9.70% | 90.30% | 0.00% | 0.00% | NA |
Indica III | 913 | 28.30% | 71.70% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 34.10% | 65.80% | 0.13% | 0.00% | NA |
Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 71.10% | 28.90% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0428353570 | C -> DEL | N | N | silent_mutation | Average:39.881; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 | N | N | N | N |
vg0428353570 | C -> T | LOC_Os04g47790.1 | upstream_gene_variant ; 1939.0bp to feature; MODIFIER | silent_mutation | Average:39.881; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 | N | N | N | N |
vg0428353570 | C -> T | LOC_Os04g47780-LOC_Os04g47790 | intergenic_region ; MODIFIER | silent_mutation | Average:39.881; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0428353570 | NA | 2.37E-06 | mr1011 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0428353570 | NA | 9.98E-11 | mr1125 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0428353570 | NA | 1.18E-29 | mr1237 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0428353570 | NA | 7.34E-06 | mr1398 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0428353570 | NA | 1.76E-17 | mr1552 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0428353570 | NA | 1.51E-06 | mr1094_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0428353570 | NA | 1.68E-07 | mr1125_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |