Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0428334488:

Variant ID: vg0428334488 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 28334488
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:

AAAATTTGAAAAAAATTAGCGTATGGTTAATTAAATATTTCCTCCATCTATTTTTGATAGTCATATTTACAAATCTGAAAAAAAATTGATAGATATATTT[T/C]
AATTCAACAACTTATCATTTTAATGACTTTCTTGGATTTAATGCATGACTCTCCATTCTTCAACACAAGATTGGCTACATGAGTATCCAGAAATGTAAAT

Reverse complement sequence

ATTTACATTTCTGGATACTCATGTAGCCAATCTTGTGTTGAAGAATGGAGAGTCATGCATTAAATCCAAGAAAGTCATTAAAATGATAAGTTGTTGAATT[A/G]
AAATATATCTATCAATTTTTTTTCAGATTTGTAAATATGACTATCAAAAATAGATGGAGGAAATATTTAATTAACCATACGCTAATTTTTTTCAAATTTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.80%	40.90%	0.28%	0.00%	NA
All Indica	2759	93.80%	5.80%	0.36%	0.00%	NA
All Japonica	1512	0.60%	99.30%	0.07%	0.00%	NA
Aus	269	55.00%	45.00%	0.00%	0.00%	NA
Indica I	595	95.80%	4.00%	0.17%	0.00%	NA
Indica II	465	94.60%	5.40%	0.00%	0.00%	NA
Indica III	913	94.20%	5.60%	0.22%	0.00%	NA
Indica Intermediate	786	91.50%	7.60%	0.89%	0.00%	NA
Temperate Japonica	767	0.50%	99.30%	0.13%	0.00%	NA
Tropical Japonica	504	0.80%	99.20%	0.00%	0.00%	NA
Japonica Intermediate	241	0.40%	99.60%	0.00%	0.00%	NA
VI/Aromatic	96	0.00%	100.00%	0.00%	0.00%	NA
Intermediate	90	36.70%	61.10%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0428334488	T -> C	LOC_Os04g47770.1	upstream_gene_variant ; 2084.0bp to feature; MODIFIER	silent_mutation	Average:54.294; most accessible tissue: Zhenshan97 flower, score: 68.372	N	N	N	N
vg0428334488	T -> C	LOC_Os04g47750.1	downstream_gene_variant ; 3520.0bp to feature; MODIFIER	silent_mutation	Average:54.294; most accessible tissue: Zhenshan97 flower, score: 68.372	N	N	N	N
vg0428334488	T -> C	LOC_Os04g47760.1	downstream_gene_variant ; 1183.0bp to feature; MODIFIER	silent_mutation	Average:54.294; most accessible tissue: Zhenshan97 flower, score: 68.372	N	N	N	N
vg0428334488	T -> C	LOC_Os04g47760-LOC_Os04g47770	intergenic_region ; MODIFIER	silent_mutation	Average:54.294; most accessible tissue: Zhenshan97 flower, score: 68.372	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0428334488	NA	8.28E-27	mr1076	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488	NA	1.22E-06	mr1076	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488	NA	4.06E-08	mr1082	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488	NA	2.67E-25	mr1083	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488	7.14E-10	4.23E-12	mr1083	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488	NA	5.92E-07	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488	NA	3.58E-07	mr1104	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488	NA	3.64E-06	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488	NA	5.44E-39	mr1139	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488	NA	1.71E-27	mr1145	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488	NA	6.95E-08	mr1145	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488	NA	6.56E-30	mr1204	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488	1.11E-06	1.48E-10	mr1226	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488	NA	3.22E-09	mr1301	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488	NA	2.33E-07	mr1411	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488	NA	8.23E-22	mr1416	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488	NA	6.85E-29	mr1436	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488	NA	3.71E-06	mr1436	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488	NA	8.39E-07	mr1437	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488	NA	3.80E-08	mr1560	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488	NA	2.88E-06	mr1620	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488	NA	5.42E-10	mr1663	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488	NA	7.75E-06	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488	NA	2.88E-14	mr1579_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488	NA	3.47E-08	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251