\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0428334488:

Variant ID: vg0428334488 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 28334488
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:


AAAATTTGAAAAAAATTAGCGTATGGTTAATTAAATATTTCCTCCATCTATTTTTGATAGTCATATTTACAAATCTGAAAAAAAATTGATAGATATATTT[T/C]
AATTCAACAACTTATCATTTTAATGACTTTCTTGGATTTAATGCATGACTCTCCATTCTTCAACACAAGATTGGCTACATGAGTATCCAGAAATGTAAAT

Reverse complement sequence

ATTTACATTTCTGGATACTCATGTAGCCAATCTTGTGTTGAAGAATGGAGAGTCATGCATTAAATCCAAGAAAGTCATTAAAATGATAAGTTGTTGAATT[A/G]
AAATATATCTATCAATTTTTTTTCAGATTTGTAAATATGACTATCAAAAATAGATGGAGGAAATATTTAATTAACCATACGCTAATTTTTTTCAAATTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.80% 40.90% 0.28% 0.00% NA
All Indica  2759 93.80% 5.80% 0.36% 0.00% NA
All Japonica  1512 0.60% 99.30% 0.07% 0.00% NA
Aus  269 55.00% 45.00% 0.00% 0.00% NA
Indica I  595 95.80% 4.00% 0.17% 0.00% NA
Indica II  465 94.60% 5.40% 0.00% 0.00% NA
Indica III  913 94.20% 5.60% 0.22% 0.00% NA
Indica Intermediate  786 91.50% 7.60% 0.89% 0.00% NA
Temperate Japonica  767 0.50% 99.30% 0.13% 0.00% NA
Tropical Japonica  504 0.80% 99.20% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 0.00% 100.00% 0.00% 0.00% NA
Intermediate  90 36.70% 61.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0428334488 T -> C LOC_Os04g47770.1 upstream_gene_variant ; 2084.0bp to feature; MODIFIER silent_mutation Average:54.294; most accessible tissue: Zhenshan97 flower, score: 68.372 N N N N
vg0428334488 T -> C LOC_Os04g47750.1 downstream_gene_variant ; 3520.0bp to feature; MODIFIER silent_mutation Average:54.294; most accessible tissue: Zhenshan97 flower, score: 68.372 N N N N
vg0428334488 T -> C LOC_Os04g47760.1 downstream_gene_variant ; 1183.0bp to feature; MODIFIER silent_mutation Average:54.294; most accessible tissue: Zhenshan97 flower, score: 68.372 N N N N
vg0428334488 T -> C LOC_Os04g47760-LOC_Os04g47770 intergenic_region ; MODIFIER silent_mutation Average:54.294; most accessible tissue: Zhenshan97 flower, score: 68.372 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0428334488 NA 8.28E-27 mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488 NA 1.22E-06 mr1076 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488 NA 4.06E-08 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488 NA 2.67E-25 mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488 7.14E-10 4.23E-12 mr1083 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488 NA 5.92E-07 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488 NA 3.58E-07 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488 NA 3.64E-06 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488 NA 5.44E-39 mr1139 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488 NA 1.71E-27 mr1145 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488 NA 6.95E-08 mr1145 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488 NA 6.56E-30 mr1204 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488 1.11E-06 1.48E-10 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488 NA 3.22E-09 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488 NA 2.33E-07 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488 NA 8.23E-22 mr1416 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488 NA 6.85E-29 mr1436 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488 NA 3.71E-06 mr1436 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488 NA 8.39E-07 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488 NA 3.80E-08 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488 NA 2.88E-06 mr1620 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488 NA 5.42E-10 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488 NA 7.75E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488 NA 2.88E-14 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428334488 NA 3.47E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251