Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0428317512:

Variant ID: vg0428317512 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 28317512
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.60, C: 0.40, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:

GAACTCTGCAATCTCAAGTTCAGATCCTCAAAACCCAACCAACCAACAACCCCATAGTTTTCAAAACACAAACAACCAGCAATCCCATGGTTTCTCACCC[T/C]
ATTTTTCCATGAATTTTTCACCCATCAGTTTTGACGGAGCGTGGGGCTCCTCACCGGGAGACCGCGCAGGCCCCCCTTTGCCGGTTCGGCCGGGGGCCCT

Reverse complement sequence

AGGGCCCCCGGCCGAACCGGCAAAGGGGGGCCTGCGCGGTCTCCCGGTGAGGAGCCCCACGCTCCGTCAAAACTGATGGGTGAAAAATTCATGGAAAAAT[A/G]
GGGTGAGAAACCATGGGATTGCTGGTTGTTTGTGTTTTGAAAACTATGGGGTTGTTGGTTGGTTGGGTTTTGAGGATCTGAACTTGAGATTGCAGAGTTC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.40%	14.90%	0.36%	42.32%	NA
All Indica	2759	7.90%	20.00%	0.58%	71.51%	NA
All Japonica	1512	99.60%	0.20%	0.00%	0.20%	NA
Aus	269	45.40%	54.60%	0.00%	0.00%	NA
Indica I	595	6.40%	23.40%	1.34%	68.91%	NA
Indica II	465	6.00%	4.10%	0.00%	89.89%	NA
Indica III	913	8.20%	20.80%	0.55%	70.43%	NA
Indica Intermediate	786	9.80%	26.00%	0.38%	63.87%	NA
Temperate Japonica	767	99.70%	0.10%	0.00%	0.13%	NA
Tropical Japonica	504	99.40%	0.40%	0.00%	0.20%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	67.80%	4.40%	1.11%	26.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0428317512	T -> C	LOC_Os04g47730.1	upstream_gene_variant ; 1721.0bp to feature; MODIFIER	silent_mutation	Average:39.68; most accessible tissue: Callus, score: 74.128	N	N	N	N
vg0428317512	T -> C	LOC_Os04g47720.1	downstream_gene_variant ; 634.0bp to feature; MODIFIER	silent_mutation	Average:39.68; most accessible tissue: Callus, score: 74.128	N	N	N	N
vg0428317512	T -> C	LOC_Os04g47720-LOC_Os04g47730	intergenic_region ; MODIFIER	silent_mutation	Average:39.68; most accessible tissue: Callus, score: 74.128	N	N	N	N
vg0428317512	T -> DEL	N	N	silent_mutation	Average:39.68; most accessible tissue: Callus, score: 74.128	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0428317512	NA	4.30E-09	mr1663	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428317512	NA	3.99E-37	mr1181_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428317512	NA	1.07E-07	mr1181_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428317512	NA	7.28E-06	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428317512	NA	5.52E-07	mr1482_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428317512	2.52E-06	2.52E-06	mr1574_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428317512	NA	7.64E-08	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428317512	NA	1.21E-23	mr1708_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428317512	NA	3.60E-06	mr1733_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428317512	NA	2.97E-07	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251