\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0428287310:

Variant ID: vg0428287310 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 28287310
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTCTAGTCTCCTCTTCTAATATTTCTTATTTTTAATTCCGAATTTCAGTTATTTCCTAATTGTATTTCTATATGAACTCTAGTCTTCTCTTCTAATATT[C/T]
CTTATTTTTTAATTCCGAATTTCAACTATTTCTAAATTGTATTTCTATATGGACTCTAGCCTCCTTTTCTAATATTCCTTATTTTTTAATTCCGAATTTC

Reverse complement sequence

GAAATTCGGAATTAAAAAATAAGGAATATTAGAAAAGGAGGCTAGAGTCCATATAGAAATACAATTTAGAAATAGTTGAAATTCGGAATTAAAAAATAAG[G/A]
AATATTAGAAGAGAAGACTAGAGTTCATATAGAAATACAATTAGGAAATAACTGAAATTCGGAATTAAAAATAAGAAATATTAGAAGAGGAGACTAGAGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.60% 1.80% 1.65% 0.00% NA
All Indica  2759 99.70% 0.20% 0.07% 0.00% NA
All Japonica  1512 95.00% 1.40% 3.64% 0.00% NA
Aus  269 72.10% 21.60% 6.32% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 99.60% 0.20% 0.22% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.50% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.00% 0.26% 0.00% NA
Tropical Japonica  504 85.50% 4.20% 10.32% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 95.60% 0.00% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0428287310 C -> T LOC_Os04g47680.1 upstream_gene_variant ; 2790.0bp to feature; MODIFIER silent_mutation Average:15.89; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0428287310 C -> T LOC_Os04g47660.1 downstream_gene_variant ; 4349.0bp to feature; MODIFIER silent_mutation Average:15.89; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0428287310 C -> T LOC_Os04g47670.2 downstream_gene_variant ; 2105.0bp to feature; MODIFIER silent_mutation Average:15.89; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0428287310 C -> T LOC_Os04g47670-LOC_Os04g47680 intergenic_region ; MODIFIER silent_mutation Average:15.89; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0428287310 NA 6.00E-07 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428287310 NA 4.17E-06 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428287310 NA 5.17E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428287310 NA 2.42E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428287310 1.70E-06 1.89E-09 mr1220_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428287310 NA 2.30E-06 mr1929_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428287310 NA 7.64E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251