Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0428287310:

Variant ID: vg0428287310 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 28287310
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACTCTAGTCTCCTCTTCTAATATTTCTTATTTTTAATTCCGAATTTCAGTTATTTCCTAATTGTATTTCTATATGAACTCTAGTCTTCTCTTCTAATATT[C/T]
CTTATTTTTTAATTCCGAATTTCAACTATTTCTAAATTGTATTTCTATATGGACTCTAGCCTCCTTTTCTAATATTCCTTATTTTTTAATTCCGAATTTC

Reverse complement sequence

GAAATTCGGAATTAAAAAATAAGGAATATTAGAAAAGGAGGCTAGAGTCCATATAGAAATACAATTTAGAAATAGTTGAAATTCGGAATTAAAAAATAAG[G/A]
AATATTAGAAGAGAAGACTAGAGTTCATATAGAAATACAATTAGGAAATAACTGAAATTCGGAATTAAAAATAAGAAATATTAGAAGAGGAGACTAGAGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.60%	1.80%	1.65%	0.00%	NA
All Indica	2759	99.70%	0.20%	0.07%	0.00%	NA
All Japonica	1512	95.00%	1.40%	3.64%	0.00%	NA
Aus	269	72.10%	21.60%	6.32%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	99.60%	0.20%	0.22%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.50%	0.50%	0.00%	0.00%	NA
Temperate Japonica	767	99.70%	0.00%	0.26%	0.00%	NA
Tropical Japonica	504	85.50%	4.20%	10.32%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	0.00%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0428287310	C -> T	LOC_Os04g47680.1	upstream_gene_variant ; 2790.0bp to feature; MODIFIER	silent_mutation	Average:15.89; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg0428287310	C -> T	LOC_Os04g47660.1	downstream_gene_variant ; 4349.0bp to feature; MODIFIER	silent_mutation	Average:15.89; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg0428287310	C -> T	LOC_Os04g47670.2	downstream_gene_variant ; 2105.0bp to feature; MODIFIER	silent_mutation	Average:15.89; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg0428287310	C -> T	LOC_Os04g47670-LOC_Os04g47680	intergenic_region ; MODIFIER	silent_mutation	Average:15.89; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0428287310	NA	6.00E-07	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428287310	NA	4.17E-06	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428287310	NA	5.17E-06	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428287310	NA	2.42E-06	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428287310	1.70E-06	1.89E-09	mr1220_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428287310	NA	2.30E-06	mr1929_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428287310	NA	7.64E-06	mr1936_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251