\
| Variant ID: vg0428287310 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 28287310 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ACTCTAGTCTCCTCTTCTAATATTTCTTATTTTTAATTCCGAATTTCAGTTATTTCCTAATTGTATTTCTATATGAACTCTAGTCTTCTCTTCTAATATT[C/T]
CTTATTTTTTAATTCCGAATTTCAACTATTTCTAAATTGTATTTCTATATGGACTCTAGCCTCCTTTTCTAATATTCCTTATTTTTTAATTCCGAATTTC
GAAATTCGGAATTAAAAAATAAGGAATATTAGAAAAGGAGGCTAGAGTCCATATAGAAATACAATTTAGAAATAGTTGAAATTCGGAATTAAAAAATAAG[G/A]
AATATTAGAAGAGAAGACTAGAGTTCATATAGAAATACAATTAGGAAATAACTGAAATTCGGAATTAAAAATAAGAAATATTAGAAGAGGAGACTAGAGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.60% | 1.80% | 1.65% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.20% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 95.00% | 1.40% | 3.64% | 0.00% | NA |
| Aus | 269 | 72.10% | 21.60% | 6.32% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 85.50% | 4.20% | 10.32% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 0.00% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0428287310 | C -> T | LOC_Os04g47680.1 | upstream_gene_variant ; 2790.0bp to feature; MODIFIER | silent_mutation | Average:15.89; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0428287310 | C -> T | LOC_Os04g47660.1 | downstream_gene_variant ; 4349.0bp to feature; MODIFIER | silent_mutation | Average:15.89; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0428287310 | C -> T | LOC_Os04g47670.2 | downstream_gene_variant ; 2105.0bp to feature; MODIFIER | silent_mutation | Average:15.89; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0428287310 | C -> T | LOC_Os04g47670-LOC_Os04g47680 | intergenic_region ; MODIFIER | silent_mutation | Average:15.89; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0428287310 | NA | 6.00E-07 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428287310 | NA | 4.17E-06 | mr1076 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428287310 | NA | 5.17E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428287310 | NA | 2.42E-06 | mr1077_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428287310 | 1.70E-06 | 1.89E-09 | mr1220_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428287310 | NA | 2.30E-06 | mr1929_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428287310 | NA | 7.64E-06 | mr1936_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |