\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0428201379:

Variant ID: vg0428201379 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 28201379
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


GAATACACCAGCGGTCCTTAAACTTGTCAGAGGTTTCACTCAGGTCCACAAACTTGCAAAGCGCCCATCGAGGTCTCTAAACTTGGTTTATTGTATCATC[T/C]
CGGTCCAAACCCGCGTTTTACCGTGGTCTTGCCTACGTGGCATGCCACGTGGACGATGACATGTAATTCTTTCTCCCTTTTTCCTTTTTTTTCTCCCTTC

Reverse complement sequence

GAAGGGAGAAAAAAAAGGAAAAAGGGAGAAAGAATTACATGTCATCGTCCACGTGGCATGCCACGTAGGCAAGACCACGGTAAAACGCGGGTTTGGACCG[A/G]
GATGATACAATAAACCAAGTTTAGAGACCTCGATGGGCGCTTTGCAAGTTTGTGGACCTGAGTGAAACCTCTGACAAGTTTAAGGACCGCTGGTGTATTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.40% 32.30% 1.18% 0.11% NA
All Indica  2759 94.20% 5.10% 0.43% 0.18% NA
All Japonica  1512 11.80% 85.80% 2.38% 0.00% NA
Aus  269 96.30% 2.20% 1.49% 0.00% NA
Indica I  595 98.20% 1.30% 0.50% 0.00% NA
Indica II  465 95.90% 3.90% 0.22% 0.00% NA
Indica III  913 89.90% 8.80% 0.77% 0.55% NA
Indica Intermediate  786 95.30% 4.60% 0.13% 0.00% NA
Temperate Japonica  767 9.30% 87.00% 3.78% 0.00% NA
Tropical Japonica  504 19.40% 79.60% 0.99% 0.00% NA
Japonica Intermediate  241 3.70% 95.40% 0.83% 0.00% NA
VI/Aromatic  96 59.40% 38.50% 2.08% 0.00% NA
Intermediate  90 48.90% 48.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0428201379 T -> C LOC_Os04g47555.1 missense_variant ; p.Glu286Gly; MODERATE nonsynonymous_codon ; E286G Average:82.231; most accessible tissue: Minghui63 panicle, score: 93.735 unknown unknown TOLERATED 0.48
vg0428201379 T -> DEL LOC_Os04g47555.1 N frameshift_variant Average:82.231; most accessible tissue: Minghui63 panicle, score: 93.735 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0428201379 T C 0.03 0.05 0.04 0.03 0.03 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0428201379 NA 4.82E-14 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0428201379 NA 1.18E-11 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428201379 NA 8.98E-21 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428201379 NA 3.58E-16 mr1035_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428201379 NA 1.69E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428201379 NA 1.94E-07 mr1051_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428201379 NA 9.95E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428201379 NA 1.27E-06 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428201379 NA 8.53E-17 mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428201379 NA 1.60E-11 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428201379 NA 7.03E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428201379 NA 1.64E-16 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428201379 NA 2.86E-32 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428201379 NA 7.12E-19 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428201379 NA 2.19E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428201379 NA 1.92E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428201379 NA 4.59E-08 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428201379 NA 9.60E-06 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251