\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0428163509:

Variant ID: vg0428163509 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 28163509
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TCACAATGACAATAAACAGAAGAGGCAGTGGACGGGCCGTACAGGAGTATGATGACAGTGTTTGACGGGACTTCTAGAAATTATAAAAACGAAACCCAAC[A/G]
AGACAATAAACTCTACAAACTATACGATCCAATTTGTAAAGGTTCCAAGGAGAATGAATAGAAACGATGGTAGATCAAGCAAGCAAATAAAAAAAAGTAA

Reverse complement sequence

TTACTTTTTTTTATTTGCTTGCTTGATCTACCATCGTTTCTATTCATTCTCCTTGGAACCTTTACAAATTGGATCGTATAGTTTGTAGAGTTTATTGTCT[T/C]
GTTGGGTTTCGTTTTTATAATTTCTAGAAGTCCCGTCAAACACTGTCATCATACTCCTGTACGGCCCGTCCACTGCCTCTTCTGTTTATTGTCATTGTGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.00% 41.70% 0.32% 0.00% NA
All Indica  2759 92.30% 7.20% 0.51% 0.00% NA
All Japonica  1512 0.50% 99.50% 0.00% 0.00% NA
Aus  269 55.80% 44.20% 0.00% 0.00% NA
Indica I  595 95.00% 3.90% 1.18% 0.00% NA
Indica II  465 95.50% 4.50% 0.00% 0.00% NA
Indica III  913 88.60% 11.00% 0.44% 0.00% NA
Indica Intermediate  786 92.70% 6.90% 0.38% 0.00% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 0.80% 99.20% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 37.80% 61.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0428163509 A -> G LOC_Os04g47470.1 upstream_gene_variant ; 3076.0bp to feature; MODIFIER silent_mutation Average:36.222; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0428163509 A -> G LOC_Os04g47460.1 downstream_gene_variant ; 867.0bp to feature; MODIFIER silent_mutation Average:36.222; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0428163509 A -> G LOC_Os04g47450-LOC_Os04g47460 intergenic_region ; MODIFIER silent_mutation Average:36.222; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0428163509 9.63E-10 1.93E-07 Awn_length Ind_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0428163509 NA 6.30E-23 mr1571 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428163509 NA 5.03E-25 mr1731 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428163509 NA 9.25E-42 mr1145_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428163509 NA 7.20E-35 mr1181_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428163509 NA 4.53E-23 mr1708_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428163509 NA 1.15E-07 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428163509 NA 8.51E-36 mr1878_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251