\
| Variant ID: vg0428163509 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 28163509 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 99. )
TCACAATGACAATAAACAGAAGAGGCAGTGGACGGGCCGTACAGGAGTATGATGACAGTGTTTGACGGGACTTCTAGAAATTATAAAAACGAAACCCAAC[A/G]
AGACAATAAACTCTACAAACTATACGATCCAATTTGTAAAGGTTCCAAGGAGAATGAATAGAAACGATGGTAGATCAAGCAAGCAAATAAAAAAAAGTAA
TTACTTTTTTTTATTTGCTTGCTTGATCTACCATCGTTTCTATTCATTCTCCTTGGAACCTTTACAAATTGGATCGTATAGTTTGTAGAGTTTATTGTCT[T/C]
GTTGGGTTTCGTTTTTATAATTTCTAGAAGTCCCGTCAAACACTGTCATCATACTCCTGTACGGCCCGTCCACTGCCTCTTCTGTTTATTGTCATTGTGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.00% | 41.70% | 0.32% | 0.00% | NA |
| All Indica | 2759 | 92.30% | 7.20% | 0.51% | 0.00% | NA |
| All Japonica | 1512 | 0.50% | 99.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 55.80% | 44.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.00% | 3.90% | 1.18% | 0.00% | NA |
| Indica II | 465 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 88.60% | 11.00% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 92.70% | 6.90% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 37.80% | 61.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0428163509 | A -> G | LOC_Os04g47470.1 | upstream_gene_variant ; 3076.0bp to feature; MODIFIER | silent_mutation | Average:36.222; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg0428163509 | A -> G | LOC_Os04g47460.1 | downstream_gene_variant ; 867.0bp to feature; MODIFIER | silent_mutation | Average:36.222; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg0428163509 | A -> G | LOC_Os04g47450-LOC_Os04g47460 | intergenic_region ; MODIFIER | silent_mutation | Average:36.222; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0428163509 | 9.63E-10 | 1.93E-07 | Awn_length | Ind_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0428163509 | NA | 6.30E-23 | mr1571 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428163509 | NA | 5.03E-25 | mr1731 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428163509 | NA | 9.25E-42 | mr1145_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428163509 | NA | 7.20E-35 | mr1181_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428163509 | NA | 4.53E-23 | mr1708_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428163509 | NA | 1.15E-07 | mr1804_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428163509 | NA | 8.51E-36 | mr1878_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |