\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0428141597:

Variant ID: vg0428141597 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 28141597
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCGGCCTGACCAGGGACGGCGTGCCATGGCCGGTCTGACCGGCCGCAAGACGGCGGTCTGACCGTCGCATAGGGCCGGTCTGACCGGCGGCACATGAGCG[G/A]
TCAGACCGCCCCCCTAGAGGCCGAGATGATGTTGCTCGGGATGGCCGATATAGAGCCGACGGAGCTGTAGTCGGTCAGACCGAGCCGATGGCAGTCTGAA

Reverse complement sequence

TTCAGACTGCCATCGGCTCGGTCTGACCGACTACAGCTCCGTCGGCTCTATATCGGCCATCCCGAGCAACATCATCTCGGCCTCTAGGGGGGCGGTCTGA[C/T]
CGCTCATGTGCCGCCGGTCAGACCGGCCCTATGCGACGGTCAGACCGCCGTCTTGCGGCCGGTCAGACCGGCCATGGCACGCCGTCCCTGGTCAGGCCGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.60% 1.90% 1.50% 0.00% NA
All Indica  2759 99.70% 0.20% 0.11% 0.00% NA
All Japonica  1512 90.10% 5.70% 4.23% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 98.30% 1.30% 0.43% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 92.80% 2.30% 4.82% 0.00% NA
Tropical Japonica  504 95.40% 3.00% 1.59% 0.00% NA
Japonica Intermediate  241 70.10% 22.00% 7.88% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 0.00% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0428141597 G -> A LOC_Os04g47420.1 upstream_gene_variant ; 1692.0bp to feature; MODIFIER silent_mutation Average:55.649; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N
vg0428141597 G -> A LOC_Os04g47430.1 upstream_gene_variant ; 1409.0bp to feature; MODIFIER silent_mutation Average:55.649; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N
vg0428141597 G -> A LOC_Os04g47440.1 upstream_gene_variant ; 3358.0bp to feature; MODIFIER silent_mutation Average:55.649; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N
vg0428141597 G -> A LOC_Os04g47410.5 downstream_gene_variant ; 4812.0bp to feature; MODIFIER silent_mutation Average:55.649; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N
vg0428141597 G -> A LOC_Os04g47420-LOC_Os04g47430 intergenic_region ; MODIFIER silent_mutation Average:55.649; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0428141597 NA 6.17E-06 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428141597 NA 5.08E-06 mr1510 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428141597 NA 3.72E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428141597 NA 2.10E-06 mr1807 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428141597 3.87E-06 3.87E-06 mr1302_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428141597 NA 1.42E-06 mr1813_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428141597 NA 7.62E-07 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428141597 NA 8.20E-06 mr1894_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251