\
| Variant ID: vg0428141597 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 28141597 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCGGCCTGACCAGGGACGGCGTGCCATGGCCGGTCTGACCGGCCGCAAGACGGCGGTCTGACCGTCGCATAGGGCCGGTCTGACCGGCGGCACATGAGCG[G/A]
TCAGACCGCCCCCCTAGAGGCCGAGATGATGTTGCTCGGGATGGCCGATATAGAGCCGACGGAGCTGTAGTCGGTCAGACCGAGCCGATGGCAGTCTGAA
TTCAGACTGCCATCGGCTCGGTCTGACCGACTACAGCTCCGTCGGCTCTATATCGGCCATCCCGAGCAACATCATCTCGGCCTCTAGGGGGGCGGTCTGA[C/T]
CGCTCATGTGCCGCCGGTCAGACCGGCCCTATGCGACGGTCAGACCGCCGTCTTGCGGCCGGTCAGACCGGCCATGGCACGCCGTCCCTGGTCAGGCCGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.60% | 1.90% | 1.50% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.20% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 90.10% | 5.70% | 4.23% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.30% | 1.30% | 0.43% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 92.80% | 2.30% | 4.82% | 0.00% | NA |
| Tropical Japonica | 504 | 95.40% | 3.00% | 1.59% | 0.00% | NA |
| Japonica Intermediate | 241 | 70.10% | 22.00% | 7.88% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 0.00% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0428141597 | G -> A | LOC_Os04g47420.1 | upstream_gene_variant ; 1692.0bp to feature; MODIFIER | silent_mutation | Average:55.649; most accessible tissue: Zhenshan97 panicle, score: 75.67 | N | N | N | N |
| vg0428141597 | G -> A | LOC_Os04g47430.1 | upstream_gene_variant ; 1409.0bp to feature; MODIFIER | silent_mutation | Average:55.649; most accessible tissue: Zhenshan97 panicle, score: 75.67 | N | N | N | N |
| vg0428141597 | G -> A | LOC_Os04g47440.1 | upstream_gene_variant ; 3358.0bp to feature; MODIFIER | silent_mutation | Average:55.649; most accessible tissue: Zhenshan97 panicle, score: 75.67 | N | N | N | N |
| vg0428141597 | G -> A | LOC_Os04g47410.5 | downstream_gene_variant ; 4812.0bp to feature; MODIFIER | silent_mutation | Average:55.649; most accessible tissue: Zhenshan97 panicle, score: 75.67 | N | N | N | N |
| vg0428141597 | G -> A | LOC_Os04g47420-LOC_Os04g47430 | intergenic_region ; MODIFIER | silent_mutation | Average:55.649; most accessible tissue: Zhenshan97 panicle, score: 75.67 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0428141597 | NA | 6.17E-06 | mr1280 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428141597 | NA | 5.08E-06 | mr1510 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428141597 | NA | 3.72E-06 | mr1788 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428141597 | NA | 2.10E-06 | mr1807 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428141597 | 3.87E-06 | 3.87E-06 | mr1302_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428141597 | NA | 1.42E-06 | mr1813_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428141597 | NA | 7.62E-07 | mr1865_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428141597 | NA | 8.20E-06 | mr1894_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |