\
| Variant ID: vg0428135712 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 28135712 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 250. )
GTTGAAGATCTGAATGTCTTATGTGTCATAAATACACAAACCAACCGTGATCCAGGGTTTACTACTTCGGTATGCACAAAGCTACTGCATGCAGGGGCGC[T/C]
AGGAGGGGGGTGGGGGCTGAAATTTTGGAATGAAAAAAGTGAAAACTGAGCAACTTTTGACTAAATTTGAATAATTCACAAAGAAAAACAAATGAAAAAG
CTTTTTCATTTGTTTTTCTTTGTGAATTATTCAAATTTAGTCAAAAGTTGCTCAGTTTTCACTTTTTTCATTCCAAAATTTCAGCCCCCACCCCCCTCCT[A/G]
GCGCCCCTGCATGCAGTAGCTTTGTGCATACCGAAGTAGTAAACCCTGGATCACGGTTGGTTTGTGTATTTATGACACATAAGACATTCAGATCTTCAAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.30% | 32.20% | 1.54% | 0.00% | NA |
| All Indica | 2759 | 94.50% | 5.10% | 0.40% | 0.00% | NA |
| All Japonica | 1512 | 14.60% | 81.80% | 3.57% | 0.00% | NA |
| Aus | 269 | 96.70% | 1.50% | 1.86% | 0.00% | NA |
| Indica I | 595 | 97.50% | 1.70% | 0.84% | 0.00% | NA |
| Indica II | 465 | 95.90% | 3.70% | 0.43% | 0.00% | NA |
| Indica III | 913 | 90.90% | 9.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 95.70% | 3.90% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 8.10% | 86.20% | 5.74% | 0.00% | NA |
| Tropical Japonica | 504 | 29.20% | 68.80% | 1.98% | 0.00% | NA |
| Japonica Intermediate | 241 | 5.00% | 95.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 3.10% | 96.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 45.60% | 51.10% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0428135712 | T -> C | LOC_Os04g47420.1 | downstream_gene_variant ; 2021.0bp to feature; MODIFIER | silent_mutation | Average:56.397; most accessible tissue: Callus, score: 79.22 | N | N | N | N |
| vg0428135712 | T -> C | LOC_Os04g47410.1 | intron_variant ; MODIFIER | silent_mutation | Average:56.397; most accessible tissue: Callus, score: 79.22 | N | N | N | N |
| vg0428135712 | T -> C | LOC_Os04g47410.4 | intron_variant ; MODIFIER | silent_mutation | Average:56.397; most accessible tissue: Callus, score: 79.22 | N | N | N | N |
| vg0428135712 | T -> C | LOC_Os04g47410.3 | intron_variant ; MODIFIER | silent_mutation | Average:56.397; most accessible tissue: Callus, score: 79.22 | N | N | N | N |
| vg0428135712 | T -> C | LOC_Os04g47410.5 | intron_variant ; MODIFIER | silent_mutation | Average:56.397; most accessible tissue: Callus, score: 79.22 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0428135712 | NA | 3.75E-12 | Grain_weight | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0428135712 | NA | 4.71E-07 | mr1781 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428135712 | NA | 2.56E-21 | mr1010_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428135712 | NA | 3.67E-15 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428135712 | NA | 1.95E-07 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428135712 | NA | 6.76E-06 | mr1051_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428135712 | NA | 8.10E-07 | mr1053_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428135712 | NA | 2.19E-23 | mr1077_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428135712 | NA | 7.59E-06 | mr1092_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428135712 | 7.28E-06 | NA | mr1220_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428135712 | NA | 1.99E-08 | mr1220_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428135712 | NA | 3.93E-07 | mr1252_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428135712 | NA | 8.00E-07 | mr1252_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428135712 | NA | 7.33E-06 | mr1263_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428135712 | NA | 2.96E-08 | mr1299_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428135712 | NA | 3.20E-08 | mr1482_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428135712 | NA | 1.15E-13 | mr1537_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428135712 | NA | 3.73E-17 | mr1592_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428135712 | NA | 5.56E-19 | mr1637_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428135712 | NA | 7.78E-15 | mr1713_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428135712 | NA | 7.54E-07 | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428135712 | NA | 1.80E-09 | mr1741_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428135712 | NA | 5.80E-13 | mr1770_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428135712 | NA | 5.52E-10 | mr1783_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428135712 | NA | 6.75E-08 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428135712 | NA | 1.23E-09 | mr1804_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428135712 | NA | 4.96E-08 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428135712 | NA | 5.79E-14 | mr1938_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428135712 | NA | 7.82E-06 | mr1982_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |