\
| Variant ID: vg0428087648 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 28087648 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CGATGCCTCGATCGATCGTCGGCGTCGAAGAGGGGTCAAGAACTCAAGATTAGGCGATCGATTCCATCTGACACATCGGCTGAATCATACGAGCTACCGT[C/T]
AATTGAGTACTCGTACTAACGTACGCGTGTAAATGCTACTGACTGCATGAGAGAAACTGTACAAGTCCTGTGCTTACACAATGTACTACGGCCTAGCCAT
ATGGCTAGGCCGTAGTACATTGTGTAAGCACAGGACTTGTACAGTTTCTCTCATGCAGTCAGTAGCATTTACACGCGTACGTTAGTACGAGTACTCAATT[G/A]
ACGGTAGCTCGTATGATTCAGCCGATGTGTCAGATGGAATCGATCGCCTAATCTTGAGTTCTTGACCCCTCTTCGACGCCGACGATCGATCGAGGCATCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 99.80% | 0.00% | 0.04% | 0.15% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.30% | 0.10% | 0.13% | 0.46% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 98.80% | 0.00% | 0.26% | 0.91% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0428087648 | C -> T | LOC_Os04g47320.1 | upstream_gene_variant ; 3491.0bp to feature; MODIFIER | N | Average:41.682; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0428087648 | C -> T | LOC_Os04g47310.1 | downstream_gene_variant ; 1798.0bp to feature; MODIFIER | N | Average:41.682; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0428087648 | C -> T | LOC_Os04g47310-LOC_Os04g47320 | intergenic_region ; MODIFIER | N | Average:41.682; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0428087648 | 7.08E-06 | 7.08E-06 | mr1099 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428087648 | 8.79E-06 | NA | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428087648 | 4.71E-06 | NA | mr1120 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428087648 | NA | 9.68E-06 | mr1596 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428087648 | 2.69E-06 | 2.69E-06 | mr1868 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428087648 | 6.79E-06 | NA | mr1917 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428087648 | 1.92E-06 | 1.92E-06 | mr1967 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |