\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0428087648:

Variant ID: vg0428087648 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 28087648
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGATGCCTCGATCGATCGTCGGCGTCGAAGAGGGGTCAAGAACTCAAGATTAGGCGATCGATTCCATCTGACACATCGGCTGAATCATACGAGCTACCGT[C/T]
AATTGAGTACTCGTACTAACGTACGCGTGTAAATGCTACTGACTGCATGAGAGAAACTGTACAAGTCCTGTGCTTACACAATGTACTACGGCCTAGCCAT

Reverse complement sequence

ATGGCTAGGCCGTAGTACATTGTGTAAGCACAGGACTTGTACAGTTTCTCTCATGCAGTCAGTAGCATTTACACGCGTACGTTAGTACGAGTACTCAATT[G/A]
ACGGTAGCTCGTATGATTCAGCCGATGTGTCAGATGGAATCGATCGCCTAATCTTGAGTTCTTGACCCCTCTTCGACGCCGACGATCGATCGAGGCATCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 99.80% 0.00% 0.04% 0.15% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 99.30% 0.10% 0.13% 0.46% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 98.80% 0.00% 0.26% 0.91% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0428087648 C -> T LOC_Os04g47320.1 upstream_gene_variant ; 3491.0bp to feature; MODIFIER N Average:41.682; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0428087648 C -> T LOC_Os04g47310.1 downstream_gene_variant ; 1798.0bp to feature; MODIFIER N Average:41.682; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0428087648 C -> T LOC_Os04g47310-LOC_Os04g47320 intergenic_region ; MODIFIER N Average:41.682; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0428087648 7.08E-06 7.08E-06 mr1099 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428087648 8.79E-06 NA mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428087648 4.71E-06 NA mr1120 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428087648 NA 9.68E-06 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428087648 2.69E-06 2.69E-06 mr1868 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428087648 6.79E-06 NA mr1917 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428087648 1.92E-06 1.92E-06 mr1967 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251