\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0428063590:

Variant ID: vg0428063590 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 28063590
Reference Allele: AAlternative Allele: T,AAT,C
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 130. )

Flanking Sequence (100 bp) in Reference Genome:


CCCTGACCTGAGATCGAGAGAGAGAAGCGAGACGATATATAGGAGTAGAACCTGCCCGAGAAGCAATGCGATGGATGGCAATTAATATACAGAAGGGAAA[A/T,AAT,C]
ATATATATATACAGAGTTGCCAGGATGCCACTCTACTCCAGCTGCAAGTGCATGCTCGGTACAGTATATATCGAGCGTCCGGGCGGACCATAAATCGCCG

Reverse complement sequence

CGGCGATTTATGGTCCGCCCGGACGCTCGATATATACTGTACCGAGCATGCACTTGCAGCTGGAGTAGAGTGGCATCCTGGCAACTCTGTATATATATAT[T/A,ATT,G]
TTTCCCTTCTGTATATTAATTGCCATCCATCGCATTGCTTCTCGGGCAGGTTCTACTCCTATATATCGTCTCGCTTCTCTCTCTCGATCTCAGGTCAGGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.50% 9.20% 0.04% 0.00% AAT: 0.25%; C: 0.02%
All Indica  2759 84.50% 15.40% 0.04% 0.00% AAT: 0.04%
All Japonica  1512 99.70% 0.10% 0.00% 0.00% C: 0.07%; AAT: 0.07%
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 38.50% 61.30% 0.22% 0.00% NA
Indica III  913 98.60% 1.30% 0.00% 0.00% AAT: 0.11%
Indica Intermediate  786 83.60% 16.40% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.00% 0.00% 0.00% C: 0.13%; AAT: 0.13%
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 88.50% 0.00% 1.04% 0.00% AAT: 10.42%
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0428063590 A -> C LOC_Os04g47250.1 5_prime_UTR_premature_start_codon_gain_variant ; LOW silent_mutation Average:91.229; most accessible tissue: Zhenshan97 panicle, score: 97.905 N N N N
vg0428063590 A -> C LOC_Os04g47250.1 5_prime_UTR_variant ; 256.0bp to feature; MODIFIER silent_mutation Average:91.229; most accessible tissue: Zhenshan97 panicle, score: 97.905 N N N N
vg0428063590 A -> C LOC_Os04g47260.1 upstream_gene_variant ; 1402.0bp to feature; MODIFIER silent_mutation Average:91.229; most accessible tissue: Zhenshan97 panicle, score: 97.905 N N N N
vg0428063590 A -> C LOC_Os04g47270.1 downstream_gene_variant ; 3506.0bp to feature; MODIFIER silent_mutation Average:91.229; most accessible tissue: Zhenshan97 panicle, score: 97.905 N N N N
vg0428063590 A -> AAT LOC_Os04g47250.1 5_prime_UTR_variant ; 257.0bp to feature; MODIFIER silent_mutation Average:91.229; most accessible tissue: Zhenshan97 panicle, score: 97.905 N N N N
vg0428063590 A -> AAT LOC_Os04g47260.1 upstream_gene_variant ; 1401.0bp to feature; MODIFIER silent_mutation Average:91.229; most accessible tissue: Zhenshan97 panicle, score: 97.905 N N N N
vg0428063590 A -> AAT LOC_Os04g47270.1 downstream_gene_variant ; 3505.0bp to feature; MODIFIER silent_mutation Average:91.229; most accessible tissue: Zhenshan97 panicle, score: 97.905 N N N N
vg0428063590 A -> T LOC_Os04g47250.1 5_prime_UTR_variant ; 256.0bp to feature; MODIFIER silent_mutation Average:91.229; most accessible tissue: Zhenshan97 panicle, score: 97.905 N N N N
vg0428063590 A -> T LOC_Os04g47260.1 upstream_gene_variant ; 1402.0bp to feature; MODIFIER silent_mutation Average:91.229; most accessible tissue: Zhenshan97 panicle, score: 97.905 N N N N
vg0428063590 A -> T LOC_Os04g47270.1 downstream_gene_variant ; 3506.0bp to feature; MODIFIER silent_mutation Average:91.229; most accessible tissue: Zhenshan97 panicle, score: 97.905 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0428063590 A AAT -0.18 -0.07 -0.03 -0.04 -0.08 -0.2
vg0428063590 A C -0.07 -0.09 -0.08 0.02 -0.01 -0.02
vg0428063590 A T 0.05 0.01 -0.01 0.02 0.0 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0428063590 NA 8.72E-06 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428063590 NA 9.46E-14 mr1169 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428063590 NA 5.38E-10 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428063590 NA 2.72E-12 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428063590 NA 1.38E-08 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428063590 NA 3.82E-06 mr1347 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428063590 NA 1.30E-07 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428063590 NA 7.01E-09 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428063590 NA 2.67E-09 mr1934 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428063590 NA 4.05E-10 mr1935 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428063590 NA 2.46E-08 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428063590 NA 2.23E-06 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428063590 NA 1.94E-06 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428063590 NA 3.45E-14 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428063590 NA 4.06E-11 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428063590 NA 3.91E-09 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428063590 NA 1.55E-06 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428063590 NA 5.55E-10 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428063590 NA 7.26E-09 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428063590 NA 3.43E-06 mr1349_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428063590 NA 4.60E-09 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428063590 NA 1.26E-10 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428063590 NA 5.73E-07 mr1449_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428063590 NA 6.14E-06 mr1536_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428063590 NA 1.78E-06 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428063590 NA 4.43E-06 mr1551_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428063590 NA 5.49E-06 mr1552_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428063590 1.61E-06 1.60E-06 mr1630_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428063590 NA 5.06E-06 mr1668_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428063590 NA 3.92E-06 mr1720_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428063590 NA 3.34E-07 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428063590 2.51E-06 2.51E-06 mr1848_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428063590 NA 4.32E-07 mr1896_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428063590 NA 1.57E-06 mr1931_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428063590 NA 1.40E-07 mr1931_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428063590 NA 6.33E-10 mr1934_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251