Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0428025706:

Variant ID: vg0428025706 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 28025706
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAAAAATAGATTAATTTAATTTTTTAAGCAACTCTCGTATAGAAATTTTTTTAAAAAAACACATCGTTTAACAGTTTGAAAAGGATGCGCGCAGAAAA[C/T]
GAGGAAGATGGGTTGGGAGAAGAGGTTGCAAATACATCCTAGGCTAACTTGTTTGCAAACTCTTACCTGTTTATTTCTGAAAATTCATGTATTTGGGTAA

Reverse complement sequence

TTACCCAAATACATGAATTTTCAGAAATAAACAGGTAAGAGTTTGCAAACAAGTTAGCCTAGGATGTATTTGCAACCTCTTCTCCCAACCCATCTTCCTC[G/A]
TTTTCTGCGCGCATCCTTTTCAAACTGTTAAACGATGTGTTTTTTTAAAAAAATTTCTATACGAGAGTTGCTTAAAAAATTAAATTAATCTATTTTTTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.70% 24.90% 0.40% 0.00% NA
All Indica  2759 62.10% 37.40% 0.58% 0.00% NA
All Japonica  1512 99.70% 0.20% 0.07% 0.00% NA
Aus  269 49.40% 50.20% 0.37% 0.00% NA
Indica I  595 18.20% 81.00% 0.84% 0.00% NA
Indica II  465 91.40% 8.40% 0.22% 0.00% NA
Indica III  913 79.50% 20.50% 0.00% 0.00% NA
Indica Intermediate  786 57.60% 41.10% 1.27% 0.00% NA
Temperate Japonica  767 99.70% 0.10% 0.13% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 10.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0428025706 C -> T LOC_Os04g47180.1 upstream_gene_variant ; 3735.0bp to feature; MODIFIER silent_mutation Average:68.535; most accessible tissue: Minghui63 root, score: 88.829 N N N N
vg0428025706 C -> T LOC_Os04g47180.2 upstream_gene_variant ; 3745.0bp to feature; MODIFIER silent_mutation Average:68.535; most accessible tissue: Minghui63 root, score: 88.829 N N N N
vg0428025706 C -> T LOC_Os04g47190.1 downstream_gene_variant ; 745.0bp to feature; MODIFIER silent_mutation Average:68.535; most accessible tissue: Minghui63 root, score: 88.829 N N N N
vg0428025706 C -> T LOC_Os04g47190.2 downstream_gene_variant ; 745.0bp to feature; MODIFIER silent_mutation Average:68.535; most accessible tissue: Minghui63 root, score: 88.829 N N N N
vg0428025706 C -> T LOC_Os04g47180-LOC_Os04g47190 intergenic_region ; MODIFIER silent_mutation Average:68.535; most accessible tissue: Minghui63 root, score: 88.829 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0428025706 C T -0.01 -0.01 0.0 -0.02 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0428025706 NA 5.18E-16 Grain_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0428025706 NA 1.64E-12 Grain_width Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0428025706 NA 8.26E-06 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428025706 NA 2.78E-07 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428025706 NA 5.33E-06 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428025706 NA 1.92E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428025706 NA 5.81E-06 mr1192 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428025706 NA 5.62E-12 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428025706 NA 4.88E-09 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428025706 NA 6.67E-07 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428025706 NA 1.46E-08 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428025706 NA 6.23E-08 mr1731 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428025706 NA 9.72E-06 mr1942 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428025706 NA 3.20E-10 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428025706 NA 3.89E-11 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428025706 NA 1.59E-06 mr1406_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428025706 NA 7.84E-07 mr1406_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428025706 NA 4.11E-07 mr1539_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428025706 NA 1.51E-08 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428025706 NA 3.57E-08 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428025706 NA 3.80E-10 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428025706 NA 1.07E-08 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428025706 NA 3.11E-09 mr1895_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428025706 NA 5.37E-06 mr1955_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251