\
| Variant ID: vg0427970215 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 27970215 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ACCGAGTTAAATATGAGGCAAAGAAGATGGCTGGAACTAATCAAGGATTACGATCTTGGAATCCATTACCATCCTGGTAAAGCTAACGTGGTCGCTGATG[C/T]
GCTAAGTCGCAAGGTCTATTGCAACGTAGCTCAAATATGGCCTGACCAAGATCGCCTGTGCAGAGAATTGGAGAAGTTGAGGCTGACCGTGGTACAGTCA
TGACTGTACCACGGTCAGCCTCAACTTCTCCAATTCTCTGCACAGGCGATCTTGGTCAGGCCATATTTGAGCTACGTTGCAATAGACCTTGCGACTTAGC[G/A]
CATCAGCGACCACGTTAGCTTTACCAGGATGGTAATGGATTCCAAGATCGTAATCCTTGATTAGTTCCAGCCATCTTCTTTGCCTCATATTTAACTCGGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.00% | 0.30% | 6.92% | 40.84% | NA |
| All Indica | 2759 | 23.50% | 0.40% | 10.69% | 65.42% | NA |
| All Japonica | 1512 | 99.70% | 0.00% | 0.00% | 0.33% | NA |
| Aus | 269 | 52.40% | 0.40% | 10.78% | 36.43% | NA |
| Indica I | 595 | 22.00% | 0.50% | 7.39% | 70.08% | NA |
| Indica II | 465 | 14.00% | 1.10% | 6.67% | 78.28% | NA |
| Indica III | 913 | 28.30% | 0.10% | 15.77% | 55.86% | NA |
| Indica Intermediate | 786 | 24.60% | 0.40% | 9.67% | 65.39% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 0.00% | 3.33% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0427970215 | C -> DEL | LOC_Os04g47100.1 | N | frameshift_variant | Average:6.792; most accessible tissue: Minghui63 young leaf, score: 11.521 | N | N | N | N |
| vg0427970215 | C -> T | LOC_Os04g47100.1 | missense_variant ; p.Ala1332Val; MODERATE | nonsynonymous_codon ; A1332V | Average:6.792; most accessible tissue: Minghui63 young leaf, score: 11.521 | benign |
1.39 |
DELETERIOUS | 0.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0427970215 | NA | 3.85E-08 | mr1050_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427970215 | NA | 3.99E-06 | mr1245_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427970215 | NA | 6.39E-07 | mr1278_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427970215 | NA | 8.82E-07 | mr1329_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427970215 | NA | 7.08E-06 | mr1337_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427970215 | NA | 6.83E-06 | mr1445_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427970215 | NA | 1.77E-08 | mr1449_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427970215 | NA | 5.06E-09 | mr1690_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |