Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0427914020:

Variant ID: vg0427914020 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 27914020
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:

CAATAACAACATAATTTTAAATTTTGCAATAACTTTTCAAAACTACTAATGTGTAATAATTACTCTAGTCTCCTCTTCTAATATTCCTTATTTTTTAATT[A/C]
TGAATTTCAGCTATTTCTAAATTGTATTTCTATATGGACTCTGCTTTTTCTTTTTCTCTGATTAATGTGAGAATTTCTAGGCCATGAGAGCGAACGTGGA

Reverse complement sequence

TCCACGTTCGCTCTCATGGCCTAGAAATTCTCACATTAATCAGAGAAAAAGAAAAAGCAGAGTCCATATAGAAATACAATTTAGAAATAGCTGAAATTCA[T/G]
AATTAAAAAATAAGGAATATTAGAAGAGGAGACTAGAGTAATTATTACACATTAGTAGTTTTGAAAAGTTATTGCAAAATTTAAAATTATGTTGTTATTG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.20%	37.70%	12.31%	3.79%	NA
All Indica	2759	24.30%	58.40%	17.04%	0.25%	NA
All Japonica	1512	82.10%	0.40%	6.28%	11.24%	NA
Aus	269	45.00%	52.00%	2.97%	0.00%	NA
Indica I	595	20.20%	63.20%	15.80%	0.84%	NA
Indica II	465	13.80%	51.60%	34.19%	0.43%	NA
Indica III	913	30.30%	59.80%	9.86%	0.00%	NA
Indica Intermediate	786	26.60%	57.30%	16.16%	0.00%	NA
Temperate Japonica	767	81.10%	0.30%	6.39%	12.26%	NA
Tropical Japonica	504	94.60%	0.20%	2.18%	2.98%	NA
Japonica Intermediate	241	58.90%	1.20%	14.52%	25.31%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	64.40%	24.40%	8.89%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0427914020	A -> C	LOC_Os04g47059.1	downstream_gene_variant ; 1578.0bp to feature; MODIFIER	silent_mutation	Average:26.801; most accessible tissue: Callus, score: 42.921	N	N	N	N
vg0427914020	A -> C	LOC_Os04g47040-LOC_Os04g47059	intergenic_region ; MODIFIER	silent_mutation	Average:26.801; most accessible tissue: Callus, score: 42.921	N	N	N	N
vg0427914020	A -> DEL	N	N	silent_mutation	Average:26.801; most accessible tissue: Callus, score: 42.921	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0427914020	1.04E-06	NA	mr1679	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427914020	NA	4.29E-06	mr1691	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427914020	2.58E-06	3.30E-07	mr1720	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427914020	NA	8.20E-06	mr1181_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427914020	NA	9.70E-06	mr1872_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251