\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0427867420:

Variant ID: vg0427867420 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 27867420
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.10, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


TCCGTTCCATAATATAAAGGATTATGACCTTTTACTTGTACTGTTTGACCACTCGTCTTATTAAAAAAAATTATGCAAATATAAAAAATGAAAAGTTGCG[T/C]
TTAAAGTACTTTGGATAATAAAGCCAGTCACAAATAAAATAAATAATAATTCTAAATTATTTTTGAATAATATAAAATCCTAAAATATAACACTTTTTAG

Reverse complement sequence

CTAAAAAGTGTTATATTTTAGGATTTTATATTATTCAAAAATAATTTAGAATTATTATTTATTTTATTTGTGACTGGCTTTATTATCCAAAGTACTTTAA[A/G]
CGCAACTTTTCATTTTTTATATTTGCATAATTTTTTTTAATAAGACGAGTGGTCAAACAGTACAAGTAAAAGGTCATAATCCTTTATATTATGGAACGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.40% 48.40% 0.25% 0.00% NA
All Indica  2759 80.70% 18.80% 0.43% 0.00% NA
All Japonica  1512 0.50% 99.50% 0.00% 0.00% NA
Aus  269 59.10% 40.90% 0.00% 0.00% NA
Indica I  595 80.50% 19.20% 0.34% 0.00% NA
Indica II  465 91.60% 8.00% 0.43% 0.00% NA
Indica III  913 76.90% 22.70% 0.44% 0.00% NA
Indica Intermediate  786 78.90% 20.60% 0.51% 0.00% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 0.60% 99.40% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 36.70% 63.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0427867420 T -> C LOC_Os04g47010.1 upstream_gene_variant ; 835.0bp to feature; MODIFIER silent_mutation Average:53.684; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0427867420 T -> C LOC_Os04g47020.1 upstream_gene_variant ; 664.0bp to feature; MODIFIER silent_mutation Average:53.684; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0427867420 T -> C LOC_Os04g47020.2 upstream_gene_variant ; 658.0bp to feature; MODIFIER silent_mutation Average:53.684; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0427867420 T -> C LOC_Os04g47020.3 upstream_gene_variant ; 664.0bp to feature; MODIFIER silent_mutation Average:53.684; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0427867420 T -> C LOC_Os04g47030.1 downstream_gene_variant ; 3729.0bp to feature; MODIFIER silent_mutation Average:53.684; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0427867420 T -> C LOC_Os04g47010-LOC_Os04g47020 intergenic_region ; MODIFIER silent_mutation Average:53.684; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0427867420 7.61E-07 NA mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427867420 1.53E-06 2.82E-07 mr1873 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427867420 NA 1.92E-15 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427867420 NA 7.69E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427867420 2.60E-06 2.56E-36 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427867420 5.81E-07 1.65E-08 mr1873_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251