Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0427867301:

Variant ID: vg0427867301 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 27867301
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

TATTACTATATTTAAAGTCCATGTATGTGAGTCCCATATATATTAATCACTTTTTGCTATATACATTGCTGATGCTGTGATTACTCTTATTCCCACATTG[T/C]
AGATACTGCTATACTCCCTCCGTTCCATAATATAAAGGATTATGACCTTTTACTTGTACTGTTTGACCACTCGTCTTATTAAAAAAAATTATGCAAATAT

Reverse complement sequence

ATATTTGCATAATTTTTTTTAATAAGACGAGTGGTCAAACAGTACAAGTAAAAGGTCATAATCCTTTATATTATGGAACGGAGGGAGTATAGCAGTATCT[A/G]
CAATGTGGGAATAAGAGTAATCACAGCATCAGCAATGTATATAGCAAAAAGTGATTAATATATATGGGACTCACATACATGGACTTTAAATATAGTAATA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.30%	48.40%	0.28%	0.00%	NA
All Indica	2759	80.80%	18.80%	0.40%	0.00%	NA
All Japonica	1512	0.50%	99.40%	0.07%	0.00%	NA
Aus	269	59.10%	40.90%	0.00%	0.00%	NA
Indica I	595	80.80%	19.00%	0.17%	0.00%	NA
Indica II	465	91.40%	8.00%	0.65%	0.00%	NA
Indica III	913	77.10%	22.70%	0.22%	0.00%	NA
Indica Intermediate	786	78.60%	20.70%	0.64%	0.00%	NA
Temperate Japonica	767	0.40%	99.60%	0.00%	0.00%	NA
Tropical Japonica	504	0.60%	99.40%	0.00%	0.00%	NA
Japonica Intermediate	241	0.80%	98.80%	0.41%	0.00%	NA
VI/Aromatic	96	1.00%	99.00%	0.00%	0.00%	NA
Intermediate	90	33.30%	65.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0427867301	T -> C	LOC_Os04g47010.1	upstream_gene_variant ; 716.0bp to feature; MODIFIER	silent_mutation	Average:57.068; most accessible tissue: Callus, score: 91.212	N	N	N	N
vg0427867301	T -> C	LOC_Os04g47020.1	upstream_gene_variant ; 783.0bp to feature; MODIFIER	silent_mutation	Average:57.068; most accessible tissue: Callus, score: 91.212	N	N	N	N
vg0427867301	T -> C	LOC_Os04g47020.2	upstream_gene_variant ; 777.0bp to feature; MODIFIER	silent_mutation	Average:57.068; most accessible tissue: Callus, score: 91.212	N	N	N	N
vg0427867301	T -> C	LOC_Os04g47020.3	upstream_gene_variant ; 783.0bp to feature; MODIFIER	silent_mutation	Average:57.068; most accessible tissue: Callus, score: 91.212	N	N	N	N
vg0427867301	T -> C	LOC_Os04g47030.1	downstream_gene_variant ; 3848.0bp to feature; MODIFIER	silent_mutation	Average:57.068; most accessible tissue: Callus, score: 91.212	N	N	N	N
vg0427867301	T -> C	LOC_Os04g47010-LOC_Os04g47020	intergenic_region ; MODIFIER	silent_mutation	Average:57.068; most accessible tissue: Callus, score: 91.212	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0427867301	3.80E-08	8.54E-41	mr1873	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427867301	1.45E-06	1.08E-07	mr1873	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427867301	NA	3.71E-06	mr1522_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427867301	NA	2.41E-16	mr1579_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427867301	NA	4.81E-36	mr1873_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427867301	NA	1.00E-06	mr1873_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251