\
| Variant ID: vg0427861897 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 27861897 |
| Reference Allele: G | Alternative Allele: A,C |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 263. )
ATCTTCACGATCAATACAATTCGGCGCATCGCCACCTTTTACCTTTTCTACTTTATTTTATCGTCCGGCGGAACTTGGCACCTGACGCGGGGCTGCATCG[G/A,C]
TGTTCGATCTCCGGCTAAGGGGTAAGTCCAATGTTTCGCTGGCCCGGGCAATTGTATCATTTACGTCGGCGTCGTTCAAGGCTGCATCAGTACATTCGAC
GTCGAATGTACTGATGCAGCCTTGAACGACGCCGACGTAAATGATACAATTGCCCGGGCCAGCGAAACATTGGACTTACCCCTTAGCCGGAGATCGAACA[C/T,G]
CGATGCAGCCCCGCGTCAGGTGCCAAGTTCCGCCGGACGATAAAATAAAGTAGAAAAGGTAAAAGGTGGCGATGCGCCGAATTGTATTGATCGTGAAGAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.60% | 34.20% | 0.23% | 0.02% | NA |
| All Indica | 2759 | 41.70% | 57.90% | 0.36% | 0.04% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 19.00% | 80.50% | 0.50% | 0.00% | NA |
| Indica II | 465 | 72.50% | 27.10% | 0.43% | 0.00% | NA |
| Indica III | 913 | 37.50% | 62.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 45.50% | 53.80% | 0.51% | 0.13% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 16.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0427861897 | G -> C | LOC_Os04g47000.1 | upstream_gene_variant ; 1021.0bp to feature; MODIFIER | N | Average:38.389; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg0427861897 | G -> C | LOC_Os04g47010.1 | downstream_gene_variant ; 2188.0bp to feature; MODIFIER | N | Average:38.389; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg0427861897 | G -> C | LOC_Os04g47000-LOC_Os04g47010 | intergenic_region ; MODIFIER | N | Average:38.389; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg0427861897 | G -> DEL | N | N | silent_mutation | Average:38.389; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg0427861897 | G -> A | LOC_Os04g47000.1 | upstream_gene_variant ; 1021.0bp to feature; MODIFIER | silent_mutation | Average:38.389; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg0427861897 | G -> A | LOC_Os04g47010.1 | downstream_gene_variant ; 2188.0bp to feature; MODIFIER | silent_mutation | Average:38.389; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg0427861897 | G -> A | LOC_Os04g47000-LOC_Os04g47010 | intergenic_region ; MODIFIER | silent_mutation | Average:38.389; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0427861897 | NA | 1.42E-10 | mr1174 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427861897 | NA | 2.98E-06 | mr1347 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427861897 | NA | 6.89E-10 | mr1174_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427861897 | NA | 1.94E-06 | mr1298_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427861897 | NA | 4.86E-11 | mr1347_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427861897 | NA | 5.32E-07 | mr1354_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427861897 | NA | 4.52E-06 | mr1720_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427861897 | 5.51E-06 | 2.37E-07 | mr1731_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427861897 | NA | 7.86E-06 | mr1942_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |