\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0427861897:

Variant ID: vg0427861897 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 27861897
Reference Allele: GAlternative Allele: A,C
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


ATCTTCACGATCAATACAATTCGGCGCATCGCCACCTTTTACCTTTTCTACTTTATTTTATCGTCCGGCGGAACTTGGCACCTGACGCGGGGCTGCATCG[G/A,C]
TGTTCGATCTCCGGCTAAGGGGTAAGTCCAATGTTTCGCTGGCCCGGGCAATTGTATCATTTACGTCGGCGTCGTTCAAGGCTGCATCAGTACATTCGAC

Reverse complement sequence

GTCGAATGTACTGATGCAGCCTTGAACGACGCCGACGTAAATGATACAATTGCCCGGGCCAGCGAAACATTGGACTTACCCCTTAGCCGGAGATCGAACA[C/T,G]
CGATGCAGCCCCGCGTCAGGTGCCAAGTTCCGCCGGACGATAAAATAAAGTAGAAAAGGTAAAAGGTGGCGATGCGCCGAATTGTATTGATCGTGAAGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.60% 34.20% 0.23% 0.02% NA
All Indica  2759 41.70% 57.90% 0.36% 0.04% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 19.00% 80.50% 0.50% 0.00% NA
Indica II  465 72.50% 27.10% 0.43% 0.00% NA
Indica III  913 37.50% 62.40% 0.11% 0.00% NA
Indica Intermediate  786 45.50% 53.80% 0.51% 0.13% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 82.20% 16.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0427861897 G -> C LOC_Os04g47000.1 upstream_gene_variant ; 1021.0bp to feature; MODIFIER N Average:38.389; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg0427861897 G -> C LOC_Os04g47010.1 downstream_gene_variant ; 2188.0bp to feature; MODIFIER N Average:38.389; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg0427861897 G -> C LOC_Os04g47000-LOC_Os04g47010 intergenic_region ; MODIFIER N Average:38.389; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg0427861897 G -> DEL N N silent_mutation Average:38.389; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg0427861897 G -> A LOC_Os04g47000.1 upstream_gene_variant ; 1021.0bp to feature; MODIFIER silent_mutation Average:38.389; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg0427861897 G -> A LOC_Os04g47010.1 downstream_gene_variant ; 2188.0bp to feature; MODIFIER silent_mutation Average:38.389; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg0427861897 G -> A LOC_Os04g47000-LOC_Os04g47010 intergenic_region ; MODIFIER silent_mutation Average:38.389; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0427861897 NA 1.42E-10 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427861897 NA 2.98E-06 mr1347 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427861897 NA 6.89E-10 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427861897 NA 1.94E-06 mr1298_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427861897 NA 4.86E-11 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427861897 NA 5.32E-07 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427861897 NA 4.52E-06 mr1720_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427861897 5.51E-06 2.37E-07 mr1731_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427861897 NA 7.86E-06 mr1942_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251