Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0427858776:

Variant ID: vg0427858776 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 27858776
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.90, A: 0.11, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

TTCCAATGATATTATTAAAGAGCTAAAATTCAAGTTTTTCTTAAAGAACTAGTTTACATATTGCTTGTTATTGACGGTGACTATTTGATCTCCTTTACTA[T/A]
CAATATTAGTTATTTGGTCTCACGGTTTATCTTTATCCCACACCCCCTAATCTCAAATCCTGGCTTCGCCCCTGATCCTACCTTACTTCTCACTCACACA

Reverse complement sequence

TGTGTGAGTGAGAAGTAAGGTAGGATCAGGGGCGAAGCCAGGATTTGAGATTAGGGGGTGTGGGATAAAGATAAACCGTGAGACCAAATAACTAATATTG[A/T]
TAGTAAAGGAGATCAAATAGTCACCGTCAATAACAAGCAATATGTAAACTAGTTCTTTAAGAAAAACTTGAATTTTAGCTCTTTAATAATATCATTGGAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.50%	48.20%	0.23%	0.06%	NA
All Indica	2759	81.40%	18.20%	0.33%	0.11%	NA
All Japonica	1512	0.40%	99.50%	0.07%	0.00%	NA
Aus	269	57.20%	42.80%	0.00%	0.00%	NA
Indica I	595	80.50%	19.20%	0.34%	0.00%	NA
Indica II	465	91.60%	8.00%	0.22%	0.22%	NA
Indica III	913	78.10%	21.60%	0.22%	0.11%	NA
Indica Intermediate	786	79.90%	19.50%	0.51%	0.13%	NA
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	0.40%	99.60%	0.00%	0.00%	NA
Japonica Intermediate	241	0.80%	98.80%	0.41%	0.00%	NA
VI/Aromatic	96	1.00%	99.00%	0.00%	0.00%	NA
Intermediate	90	31.10%	67.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0427858776	T -> DEL	N	N	silent_mutation	Average:43.185; most accessible tissue: Callus, score: 64.19	N	N	N	N
vg0427858776	T -> A	LOC_Os04g46990.1	upstream_gene_variant ; 3813.0bp to feature; MODIFIER	silent_mutation	Average:43.185; most accessible tissue: Callus, score: 64.19	N	N	N	N
vg0427858776	T -> A	LOC_Os04g47000.1	downstream_gene_variant ; 286.0bp to feature; MODIFIER	silent_mutation	Average:43.185; most accessible tissue: Callus, score: 64.19	N	N	N	N
vg0427858776	T -> A	LOC_Os04g46990-LOC_Os04g47000	intergenic_region ; MODIFIER	silent_mutation	Average:43.185; most accessible tissue: Callus, score: 64.19	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0427858776	6.17E-06	NA	mr1873	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427858776	2.10E-06	3.96E-08	mr1873	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427858776	NA	1.92E-06	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427858776	NA	6.07E-16	mr1579_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427858776	3.30E-06	3.41E-37	mr1873_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427858776	2.03E-06	5.67E-09	mr1873_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251