\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0427858776:

Variant ID: vg0427858776 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 27858776
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.90, A: 0.11, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


TTCCAATGATATTATTAAAGAGCTAAAATTCAAGTTTTTCTTAAAGAACTAGTTTACATATTGCTTGTTATTGACGGTGACTATTTGATCTCCTTTACTA[T/A]
CAATATTAGTTATTTGGTCTCACGGTTTATCTTTATCCCACACCCCCTAATCTCAAATCCTGGCTTCGCCCCTGATCCTACCTTACTTCTCACTCACACA

Reverse complement sequence

TGTGTGAGTGAGAAGTAAGGTAGGATCAGGGGCGAAGCCAGGATTTGAGATTAGGGGGTGTGGGATAAAGATAAACCGTGAGACCAAATAACTAATATTG[A/T]
TAGTAAAGGAGATCAAATAGTCACCGTCAATAACAAGCAATATGTAAACTAGTTCTTTAAGAAAAACTTGAATTTTAGCTCTTTAATAATATCATTGGAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.50% 48.20% 0.23% 0.06% NA
All Indica  2759 81.40% 18.20% 0.33% 0.11% NA
All Japonica  1512 0.40% 99.50% 0.07% 0.00% NA
Aus  269 57.20% 42.80% 0.00% 0.00% NA
Indica I  595 80.50% 19.20% 0.34% 0.00% NA
Indica II  465 91.60% 8.00% 0.22% 0.22% NA
Indica III  913 78.10% 21.60% 0.22% 0.11% NA
Indica Intermediate  786 79.90% 19.50% 0.51% 0.13% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 0.40% 99.60% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 98.80% 0.41% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 31.10% 67.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0427858776 T -> DEL N N silent_mutation Average:43.185; most accessible tissue: Callus, score: 64.19 N N N N
vg0427858776 T -> A LOC_Os04g46990.1 upstream_gene_variant ; 3813.0bp to feature; MODIFIER silent_mutation Average:43.185; most accessible tissue: Callus, score: 64.19 N N N N
vg0427858776 T -> A LOC_Os04g47000.1 downstream_gene_variant ; 286.0bp to feature; MODIFIER silent_mutation Average:43.185; most accessible tissue: Callus, score: 64.19 N N N N
vg0427858776 T -> A LOC_Os04g46990-LOC_Os04g47000 intergenic_region ; MODIFIER silent_mutation Average:43.185; most accessible tissue: Callus, score: 64.19 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0427858776 6.17E-06 NA mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427858776 2.10E-06 3.96E-08 mr1873 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427858776 NA 1.92E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427858776 NA 6.07E-16 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427858776 3.30E-06 3.41E-37 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427858776 2.03E-06 5.67E-09 mr1873_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251