Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0427825849:

Variant ID: vg0427825849 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 27825849
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:

ACTATGAAGCTAGCACTAACCTGCTATGCGTCACAACGCCCTTGGATGCCTCATCATCATCAAGCGCAAATATCGAATTGGAAGCGCCTCGGATCTTGAA[C/T]
GCCCCTCTACATCATATATTCATATCCCCACACAAGCAATTAGCAGCAGGTAGAAATTAGCATGGCAGATATGCCAAACAACACGCGGGGGGGGGGGGGG

Reverse complement sequence

CCCCCCCCCCCCCCGCGTGTTGTTTGGCATATCTGCCATGCTAATTTCTACCTGCTGCTAATTGCTTGTGTGGGGATATGAATATATGATGTAGAGGGGC[G/A]
TTCAAGATCCGAGGCGCTTCCAATTCGATATTTGCGCTTGATGATGATGAGGCATCCAAGGGCGTTGTGACGCATAGCAGGTTAGTGCTAGCTTCATAGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.60%	23.80%	0.61%	0.00%	NA
All Indica	2759	89.80%	9.90%	0.29%	0.00%	NA
All Japonica	1512	51.90%	47.00%	1.19%	0.00%	NA
Aus	269	80.70%	19.00%	0.37%	0.00%	NA
Indica I	595	85.90%	13.80%	0.34%	0.00%	NA
Indica II	465	95.50%	4.30%	0.22%	0.00%	NA
Indica III	913	89.90%	10.10%	0.00%	0.00%	NA
Indica Intermediate	786	89.30%	10.10%	0.64%	0.00%	NA
Temperate Japonica	767	25.70%	73.40%	0.91%	0.00%	NA
Tropical Japonica	504	82.70%	15.90%	1.39%	0.00%	NA
Japonica Intermediate	241	70.50%	27.80%	1.66%	0.00%	NA
VI/Aromatic	96	24.00%	75.00%	1.04%	0.00%	NA
Intermediate	90	76.70%	22.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0427825849	C -> T	LOC_Os04g46930.1	synonymous_variant ; p.Ala66Ala; LOW	synonymous_codon	Average:73.607; most accessible tissue: Minghui63 flower, score: 86.112	N	N	N	N
vg0427825849	C -> T	LOC_Os04g46930.2	synonymous_variant ; p.Ala66Ala; LOW	synonymous_codon	Average:73.607; most accessible tissue: Minghui63 flower, score: 86.112	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0427825849	NA	5.00E-10	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0427825849	NA	2.56E-14	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0427825849	NA	4.91E-18	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0427825849	NA	2.00E-16	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0427825849	NA	4.53E-06	mr1092	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427825849	NA	7.71E-07	mr1205	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427825849	NA	7.00E-07	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427825849	NA	2.67E-06	mr1318	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427825849	NA	1.08E-06	mr1531	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427825849	NA	1.53E-09	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427825849	NA	7.08E-07	mr1596	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427825849	NA	2.39E-08	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427825849	NA	8.14E-07	mr1741	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427825849	NA	5.68E-10	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427825849	NA	1.95E-06	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427825849	NA	1.44E-06	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427825849	NA	2.03E-07	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427825849	NA	2.91E-06	mr1263_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427825849	NA	2.88E-06	mr1359_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427825849	6.52E-06	NA	mr1549_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427825849	NA	7.93E-07	mr1570_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427825849	NA	3.24E-06	mr1596_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427825849	NA	2.37E-06	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427825849	NA	1.40E-06	mr1671_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427825849	NA	9.90E-08	mr1757_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427825849	NA	4.04E-08	mr1880_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251