Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0427602070:

Variant ID: vg0427602070 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 27602070
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

TAGTGGCCGGTCAGACCGTCCATGGCTCGGTCAGACCGCCGTCGGCTCGGTCTGACCGGTTGCGGCTCTAGCGGCTCTGTATCGCCACCAAAAACCAGAT[C/T]
AGTGCAACAGACCAGTGGGGCCGGTCAGACCGGCCTTACCACACCGGTCAGACCGGCTAACAGACCCGGTCAGACCGGCCTAAGGCCCACGGTCAGACCG

Reverse complement sequence

CGGTCTGACCGTGGGCCTTAGGCCGGTCTGACCGGGTCTGTTAGCCGGTCTGACCGGTGTGGTAAGGCCGGTCTGACCGGCCCCACTGGTCTGTTGCACT[G/A]
ATCTGGTTTTTGGTGGCGATACAGAGCCGCTAGAGCCGCAACCGGTCAGACCGAGCCGACGGCGGTCTGACCGAGCCATGGACGGTCTGACCGGCCACTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.20%	19.50%	0.32%	0.00%	NA
All Indica	2759	73.70%	25.80%	0.47%	0.00%	NA
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	NA
Aus	269	29.40%	70.60%	0.00%	0.00%	NA
Indica I	595	99.30%	0.70%	0.00%	0.00%	NA
Indica II	465	28.80%	71.20%	0.00%	0.00%	NA
Indica III	913	83.60%	16.00%	0.44%	0.00%	NA
Indica Intermediate	786	69.50%	29.40%	1.15%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	86.70%	11.10%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0427602070	C -> T	LOC_Os04g46540.1	upstream_gene_variant ; 4462.0bp to feature; MODIFIER	silent_mutation	Average:49.755; most accessible tissue: Minghui63 root, score: 65.279	N	N	N	N
vg0427602070	C -> T	LOC_Os04g46550.1	upstream_gene_variant ; 1934.0bp to feature; MODIFIER	silent_mutation	Average:49.755; most accessible tissue: Minghui63 root, score: 65.279	N	N	N	N
vg0427602070	C -> T	LOC_Os04g46560.1	upstream_gene_variant ; 3096.0bp to feature; MODIFIER	silent_mutation	Average:49.755; most accessible tissue: Minghui63 root, score: 65.279	N	N	N	N
vg0427602070	C -> T	LOC_Os04g46550-LOC_Os04g46560	intergenic_region ; MODIFIER	silent_mutation	Average:49.755; most accessible tissue: Minghui63 root, score: 65.279	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0427602070	NA	1.23E-06	mr1035	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427602070	NA	6.36E-07	mr1050	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427602070	NA	3.75E-06	mr1174	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427602070	NA	8.69E-08	mr1193	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427602070	NA	1.72E-06	mr1272	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427602070	NA	8.55E-07	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427602070	NA	4.58E-06	mr1324	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427602070	NA	3.13E-07	mr1354	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427602070	NA	3.58E-06	mr1387	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427602070	NA	2.45E-07	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427602070	NA	6.32E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427602070	NA	4.94E-12	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427602070	NA	8.15E-08	mr1626	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427602070	NA	2.70E-07	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427602070	NA	6.01E-07	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427602070	NA	4.71E-07	mr1798	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427602070	8.68E-06	8.67E-06	mr1035_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427602070	NA	2.48E-06	mr1158_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427602070	NA	3.37E-08	mr1354_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427602070	NA	1.09E-07	mr1458_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427602070	NA	5.15E-06	mr1631_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427602070	NA	6.93E-11	mr1715_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427602070	NA	8.11E-06	mr1720_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427602070	NA	2.68E-07	mr1895_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427602070	NA	6.56E-08	mr1931_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427602070	NA	3.93E-08	mr1931_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251