Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0427581097:

Variant ID: vg0427581097 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 27581097
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCTGGGGCGCCCCGACCCCCTGTGGTGTTGGCGCCACGTGTGTGGGTTAGGTGAGCATAGCGGCCCTCACCTAACCATATTTATAGTGGGTTAGACGAGC[G/A]
CGTCACGCCGCATTCAATGCGGCGCAGCGCATGCTTATCCGGTCTGTGACCAGTCGCGGTATGTGACCGGTCACAGACCGGTCAGATCGCGGGTTAGGTG

Reverse complement sequence

CACCTAACCCGCGATCTGACCGGTCTGTGACCGGTCACATACCGCGACTGGTCACAGACCGGATAAGCATGCGCTGCGCCGCATTGAATGCGGCGTGACG[C/T]
GCTCGTCTAACCCACTATAAATATGGTTAGGTGAGGGCCGCTATGCTCACCTAACCCACACACGTGGCGCCAACACCACAGGGGGTCGGGGCGCCCCAGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.70%	4.00%	1.42%	51.90%	NA
All Indica	2759	17.30%	0.10%	1.96%	80.68%	NA
All Japonica	1512	86.60%	12.10%	0.79%	0.53%	NA
Aus	269	28.30%	0.00%	0.37%	71.38%	NA
Indica I	595	20.50%	0.00%	1.85%	77.65%	NA
Indica II	465	9.50%	0.00%	1.08%	89.46%	NA
Indica III	913	18.00%	0.00%	2.74%	79.30%	NA
Indica Intermediate	786	18.70%	0.30%	1.65%	79.39%	NA
Temperate Japonica	767	94.90%	3.30%	1.30%	0.52%	NA
Tropical Japonica	504	89.10%	10.50%	0.00%	0.40%	NA
Japonica Intermediate	241	54.80%	43.60%	0.83%	0.83%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	67.80%	3.30%	0.00%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0427581097	G -> DEL	N	N	silent_mutation	Average:7.578; most accessible tissue: Minghui63 root, score: 13.235	N	N	N	N
vg0427581097	G -> A	LOC_Os04g46490.1	upstream_gene_variant ; 4101.0bp to feature; MODIFIER	silent_mutation	Average:7.578; most accessible tissue: Minghui63 root, score: 13.235	N	N	N	N
vg0427581097	G -> A	LOC_Os04g46500.1	upstream_gene_variant ; 1233.0bp to feature; MODIFIER	silent_mutation	Average:7.578; most accessible tissue: Minghui63 root, score: 13.235	N	N	N	N
vg0427581097	G -> A	LOC_Os04g46510.1	upstream_gene_variant ; 4324.0bp to feature; MODIFIER	silent_mutation	Average:7.578; most accessible tissue: Minghui63 root, score: 13.235	N	N	N	N
vg0427581097	G -> A	LOC_Os04g46490-LOC_Os04g46500	intergenic_region ; MODIFIER	silent_mutation	Average:7.578; most accessible tissue: Minghui63 root, score: 13.235	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0427581097	2.71E-06	NA	mr1563_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251