Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0427531252:

Variant ID: vg0427531252 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 27531252
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.05, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

TACTTTGGATGACAATGAGATTGGCTTAGAAAATTCTGCCTTTGAGTAGGCAGCACATAACAGATTTCCCCTGCAATGTATTAGGGATCACAAATAATCG[C/T]
GCACGCGGTCACCACTCGGTTTCCTTTCCCCTCCGTCAAATCGCCAACCACTGCAGCCTCTCTCCCGCACCTCCTCCAGATCGCAAATAATGCTTTATTT

Reverse complement sequence

AAATAAAGCATTATTTGCGATCTGGAGGAGGTGCGGGAGAGAGGCTGCAGTGGTTGGCGATTTGACGGAGGGGAAAGGAAACCGAGTGGTGACCGCGTGC[G/A]
CGATTATTTGTGATCCCTAATACATTGCAGGGGAAATCTGTTATGTGCTGCCTACTCAAAGGCAGAATTTTCTAAGCCAATCTCATTGTCATCCAAAGTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.70%	18.90%	0.32%	0.00%	NA
All Indica	2759	74.60%	24.90%	0.54%	0.00%	NA
All Japonica	1512	99.60%	0.40%	0.00%	0.00%	NA
Aus	269	29.00%	71.00%	0.00%	0.00%	NA
Indica I	595	99.30%	0.70%	0.00%	0.00%	NA
Indica II	465	30.50%	68.60%	0.86%	0.00%	NA
Indica III	913	84.10%	15.40%	0.44%	0.00%	NA
Indica Intermediate	786	70.70%	28.40%	0.89%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	88.90%	11.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0427531252	C -> T	LOC_Os04g46430.1	upstream_gene_variant ; 963.0bp to feature; MODIFIER	silent_mutation	Average:39.026; most accessible tissue: Minghui63 root, score: 67.149	N	N	N	N
vg0427531252	C -> T	LOC_Os04g46430-LOC_Os04g46440	intergenic_region ; MODIFIER	silent_mutation	Average:39.026; most accessible tissue: Minghui63 root, score: 67.149	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0427531252	NA	4.78E-09	mr1050	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427531252	NA	8.43E-07	mr1155	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427531252	NA	1.60E-06	mr1174	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427531252	NA	2.66E-07	mr1272	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427531252	NA	2.81E-06	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427531252	NA	2.95E-07	mr1354	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427531252	NA	6.13E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427531252	NA	7.00E-06	mr1626	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427531252	NA	4.33E-07	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427531252	NA	3.36E-07	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427531252	NA	8.83E-06	mr1733	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427531252	NA	6.23E-07	mr1798	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427531252	NA	5.35E-07	mr1050_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427531252	NA	2.89E-06	mr1158_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427531252	NA	4.36E-08	mr1170_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427531252	NA	1.23E-06	mr1272_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427531252	NA	3.92E-08	mr1354_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427531252	NA	5.26E-06	mr1355_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427531252	NA	4.59E-08	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427531252	NA	1.61E-10	mr1715_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427531252	NA	4.30E-07	mr1720_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427531252	NA	2.26E-06	mr1733_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427531252	NA	7.52E-07	mr1895_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427531252	NA	8.22E-06	mr1899_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427531252	NA	5.15E-07	mr1904_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427531252	NA	2.32E-07	mr1931_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427531252	NA	2.78E-08	mr1931_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427531252	NA	5.81E-07	mr1942_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251