Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0427491156:

Variant ID: vg0427491156 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 27491156
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.81, G: 0.20, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


GAGGAACAGTCTATATGTCCTATGCAGCCAACGAAGGTACTCTGAGAAAAGATGATTTTGGTGTATAGTCCAAGTACGGTACGAACTAACTTTGATGCAA[A/G]
CACCTCTAGAGATCTAAACTGAGACTCTTTTACCAAATCAAAGTAAACTTCCCATTCCAACTGACCTATCACATTTAATATATACTTATGCCCTTGACCA

Reverse complement sequence

TGGTCAAGGGCATAAGTATATATTAAATGTGATAGGTCAGTTGGAATGGGAAGTTTACTTTGATTTGGTAAAAGAGTCTCAGTTTAGATCTCTAGAGGTG[T/C]
TTGCATCAAAGTTAGTTCGTACCGTACTTGGACTATACACCAAAATCATCTTTTCTCAGAGTACCTTCGTTGGCTGCATAGGACATATAGACTGTTCCTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.00% 47.00% 0.04% 0.00% NA
All Indica  2759 82.50% 17.50% 0.04% 0.00% NA
All Japonica  1512 0.50% 99.50% 0.00% 0.00% NA
Aus  269 71.70% 27.90% 0.37% 0.00% NA
Indica I  595 80.70% 19.30% 0.00% 0.00% NA
Indica II  465 92.90% 7.10% 0.00% 0.00% NA
Indica III  913 80.20% 19.80% 0.00% 0.00% NA
Indica Intermediate  786 80.40% 19.50% 0.13% 0.00% NA
Temperate Japonica  767 0.70% 99.30% 0.00% 0.00% NA
Tropical Japonica  504 0.20% 99.80% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 28.90% 71.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0427491156 A -> G LOC_Os04g46360.1 upstream_gene_variant ; 3370.0bp to feature; MODIFIER silent_mutation Average:18.307; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0427491156 A -> G LOC_Os04g46370.1 downstream_gene_variant ; 3309.0bp to feature; MODIFIER silent_mutation Average:18.307; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0427491156 A -> G LOC_Os04g46370.2 downstream_gene_variant ; 3309.0bp to feature; MODIFIER silent_mutation Average:18.307; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0427491156 A -> G LOC_Os04g46370.3 downstream_gene_variant ; 3309.0bp to feature; MODIFIER silent_mutation Average:18.307; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0427491156 A -> G LOC_Os04g46370.4 downstream_gene_variant ; 3992.0bp to feature; MODIFIER silent_mutation Average:18.307; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0427491156 A -> G LOC_Os04g46360-LOC_Os04g46370 intergenic_region ; MODIFIER silent_mutation Average:18.307; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0427491156 NA 2.33E-06 mr1013 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427491156 NA 8.31E-07 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427491156 NA 7.27E-06 mr1035 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427491156 NA 1.69E-08 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427491156 NA 4.81E-07 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427491156 NA 1.73E-06 mr1157 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427491156 NA 7.56E-06 mr1163 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427491156 NA 1.49E-06 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427491156 NA 7.65E-06 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427491156 NA 5.47E-08 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427491156 NA 2.14E-06 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427491156 NA 3.39E-06 mr1324 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427491156 NA 2.84E-08 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427491156 NA 1.34E-08 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427491156 NA 5.98E-06 mr1536 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427491156 NA 2.33E-06 mr1626 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427491156 NA 9.88E-06 mr1731 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427491156 NA 4.94E-07 mr1733 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427491156 NA 2.08E-06 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427491156 NA 3.18E-09 mr1935 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427491156 NA 3.83E-06 mr1965 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427491156 NA 8.69E-09 mr1969 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427491156 3.80E-06 3.79E-06 mr1035_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427491156 NA 4.13E-07 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427491156 NA 1.22E-07 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427491156 NA 7.40E-06 mr1272_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427491156 NA 5.01E-08 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427491156 NA 2.22E-06 mr1631_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427491156 NA 9.23E-06 mr1706_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427491156 NA 2.29E-11 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427491156 NA 1.22E-06 mr1720_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427491156 NA 5.03E-06 mr1726_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427491156 NA 1.02E-07 mr1733_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427491156 NA 3.32E-09 mr1895_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427491156 NA 9.79E-07 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427491156 NA 2.23E-06 mr1931_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427491156 NA 4.43E-08 mr1942_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251