\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0427444019:

Variant ID: vg0427444019 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 27444019
Reference Allele: GTTCAAAAAlternative Allele: ATTCAAAA,G
Primary Allele: GTTCAAAASecondary Allele: ATTCAAAA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCTTAAATGTCGATCTTTTCTTTACTTTCTTTGTGATTATTTACGGTTTGGCAAGCAATATCAATCATAACAACCAGCATGATGCAACAGTTTTAAAAA[GTTCAAAA/ATTCAAAA,G]
TTTTAGTGATTTTTATTATTGGGAATTTTCAGGATGTTACAGGGACCCAATGTGGACTTATTCCAAAGCGAGGCGGGCACACCAAGCGAGCCATTTGGGC

Reverse complement sequence

GCCCAAATGGCTCGCTTGGTGTGCCCGCCTCGCTTTGGAATAAGTCCACATTGGGTCCCTGTAACATCCTGAAAATTCCCAATAATAAAAATCACTAAAA[TTTTGAAC/TTTTGAAT,C]
TTTTTAAAACTGTTGCATCATGCTGGTTGTTATGATTGATATTGCTTGCCAAACCGTAAATAATCACAAAGAAAGTAAAGAAAAGATCGACATTTAAGCA

Allele Frequencies:

Populations Population SizeFrequency of GTTCAAAA(primary allele) Frequency of ATTCAAAA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.00% 32.40% 0.49% 0.00% G: 0.08%
All Indica  2759 44.50% 54.80% 0.62% 0.00% G: 0.04%
All Japonica  1512 99.70% 0.10% 0.13% 0.00% NA
Aus  269 98.50% 0.00% 0.37% 0.00% G: 1.12%
Indica I  595 19.70% 79.70% 0.67% 0.00% NA
Indica II  465 80.00% 19.80% 0.22% 0.00% NA
Indica III  913 38.00% 61.60% 0.44% 0.00% NA
Indica Intermediate  786 49.90% 49.00% 1.02% 0.00% G: 0.13%
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 78.90% 17.80% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0427444019 GTTCAAAA -> G LOC_Os04g46310.1 upstream_gene_variant ; 442.0bp to feature; MODIFIER silent_mutation Average:95.684; most accessible tissue: Callus, score: 97.082 N N N N
vg0427444019 GTTCAAAA -> G LOC_Os04g46300-LOC_Os04g46310 intergenic_region ; MODIFIER silent_mutation Average:95.684; most accessible tissue: Callus, score: 97.082 N N N N
vg0427444019 GTTCAAAA -> ATTCAAAA LOC_Os04g46310.1 upstream_gene_variant ; 443.0bp to feature; MODIFIER silent_mutation Average:95.684; most accessible tissue: Callus, score: 97.082 N N N N
vg0427444019 GTTCAAAA -> ATTCAAAA LOC_Os04g46300-LOC_Os04g46310 intergenic_region ; MODIFIER silent_mutation Average:95.684; most accessible tissue: Callus, score: 97.082 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0427444019 GTTCA* ATTCA* -0.01 -0.01 -0.02 -0.01 -0.02 -0.02
vg0427444019 GTTCA* G 0.07 0.02 0.09 0.06 0.08 0.09

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0427444019 NA 1.26E-08 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427444019 NA 7.25E-12 mr1174_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427444019 NA 1.65E-10 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427444019 NA 8.02E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427444019 NA 5.40E-06 mr1923_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251