\
| Variant ID: vg0427391704 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 27391704 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TAACTGCTTTTGAGCCCAGTTCCATAATACAAGGCGCAGCTCCTAGTTGCATGCAGAAATTGATTAGCACTCCTGGGCTCCTATGTTGATTGCATGCATG[G/C]
AGAATTAACTGTGTTTGGCTTTTAAAAAGCCCTTCTCTCTCACTGCTTCATGGCTGCATGGCTGCAGAAGTCAGGTGCATGCTGCATGCCTCTTAATACC
GGTATTAAGAGGCATGCAGCATGCACCTGACTTCTGCAGCCATGCAGCCATGAAGCAGTGAGAGAGAAGGGCTTTTTAAAAGCCAAACACAGTTAATTCT[C/G]
CATGCATGCAATCAACATAGGAGCCCAGGAGTGCTAATCAATTTCTGCATGCAACTAGGAGCTGCGCCTTGTATTATGGAACTGGGCTCAAAAGCAGTTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.90% | 9.90% | 8.02% | 40.12% | NA |
| All Indica | 2759 | 31.10% | 0.90% | 7.97% | 59.99% | NA |
| All Japonica | 1512 | 63.20% | 28.40% | 7.94% | 0.40% | NA |
| Aus | 269 | 9.30% | 0.70% | 12.27% | 77.70% | NA |
| Indica I | 595 | 21.80% | 1.20% | 7.56% | 69.41% | NA |
| Indica II | 465 | 10.50% | 1.70% | 10.32% | 77.42% | NA |
| Indica III | 913 | 43.20% | 0.40% | 6.35% | 50.05% | NA |
| Indica Intermediate | 786 | 36.40% | 0.80% | 8.78% | 54.07% | NA |
| Temperate Japonica | 767 | 34.60% | 52.90% | 12.13% | 0.39% | NA |
| Tropical Japonica | 504 | 96.80% | 0.80% | 2.18% | 0.20% | NA |
| Japonica Intermediate | 241 | 84.20% | 8.30% | 6.64% | 0.83% | NA |
| VI/Aromatic | 96 | 94.80% | 0.00% | 1.04% | 4.17% | NA |
| Intermediate | 90 | 55.60% | 14.40% | 5.56% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0427391704 | G -> C | LOC_Os04g46220-LOC_Os04g46240 | intergenic_region ; MODIFIER | silent_mutation | Average:20.589; most accessible tissue: Callus, score: 93.838 | N | N | N | N |
| vg0427391704 | G -> DEL | N | N | silent_mutation | Average:20.589; most accessible tissue: Callus, score: 93.838 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0427391704 | NA | 1.32E-10 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0427391704 | NA | 9.78E-10 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0427391704 | NA | 1.05E-15 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0427391704 | NA | 3.50E-15 | Spikelet_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0427391704 | NA | 3.99E-12 | Spikelet_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0427391704 | NA | 2.23E-07 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427391704 | NA | 1.52E-06 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427391704 | NA | 4.70E-22 | mr1010_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427391704 | NA | 4.22E-11 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427391704 | NA | 1.44E-11 | mr1011_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427391704 | NA | 7.26E-07 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427391704 | NA | 7.20E-08 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427391704 | NA | 5.09E-07 | mr1164_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427391704 | NA | 4.82E-06 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427391704 | NA | 4.35E-06 | mr1206_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427391704 | NA | 5.96E-06 | mr1206_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427391704 | NA | 1.15E-09 | mr1229_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427391704 | NA | 1.45E-07 | mr1229_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427391704 | NA | 2.71E-08 | mr1252_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427391704 | NA | 1.56E-06 | mr1263_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427391704 | NA | 7.15E-06 | mr1263_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427391704 | NA | 9.31E-06 | mr1330_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427391704 | NA | 5.70E-06 | mr1441_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427391704 | NA | 2.36E-09 | mr1486_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427391704 | NA | 5.40E-08 | mr1555_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427391704 | NA | 2.49E-06 | mr1596_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427391704 | NA | 8.29E-06 | mr1627_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427391704 | NA | 7.02E-08 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427391704 | NA | 7.08E-08 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427391704 | NA | 9.28E-08 | mr1805_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427391704 | NA | 5.07E-06 | mr1865_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427391704 | 2.46E-06 | 6.54E-12 | mr1880_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427391704 | NA | 1.75E-09 | mr1880_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |