\
| Variant ID: vg0427390584 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 27390584 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TAAAGTAAACTGGTCACTGAAAGTCTGCTGCAGTAGTCTTTTACTAAAAGAGAACAATTACCTGCAGTCCTATATATTAGTATATTATTTCGCACAAAAT[A/G]
ATAATTAAATCTTGACCTAATCTCATAACCAGCATTTAGCCGGATGATTTGCGCAGAAACCCATCAAAGCTAGCTAGCCACTGCAGAGAGACGCAACAAG
CTTGTTGCGTCTCTCTGCAGTGGCTAGCTAGCTTTGATGGGTTTCTGCGCAAATCATCCGGCTAAATGCTGGTTATGAGATTAGGTCAAGATTTAATTAT[T/C]
ATTTTGTGCGAAATAATATACTAATATATAGGACTGCAGGTAATTGTTCTCTTTTAGTAAAAGACTACTGCAGCAGACTTTCAGTGACCAGTTTACTTTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.70% | 32.20% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 92.70% | 7.20% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 19.80% | 80.00% | 0.13% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 90.80% | 9.10% | 0.17% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 93.00% | 7.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 91.00% | 8.90% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 7.40% | 92.40% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 24.20% | 75.60% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 50.20% | 49.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 27.10% | 72.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 53.30% | 46.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0427390584 | A -> G | LOC_Os04g46220-LOC_Os04g46240 | intergenic_region ; MODIFIER | silent_mutation | Average:53.193; most accessible tissue: Callus, score: 77.538 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0427390584 | NA | 1.04E-17 | mr1767 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427390584 | NA | 3.62E-08 | mr1137_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427390584 | NA | 3.61E-07 | mr1212_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427390584 | NA | 2.88E-06 | mr1227_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427390584 | 7.15E-06 | 7.15E-06 | mr1574_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427390584 | 5.96E-06 | 2.27E-07 | mr1617_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427390584 | NA | 1.43E-06 | mr1745_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |