Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0427367311:

Variant ID: vg0427367311 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 27367311
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCGCAGGTGGAGTTCGCCCGCGCGTGATCACTTCGTCTCCACGCTGTGCTCATGCGACGCCGTGCTCAAGTGGAGCTCAGCCGTGTCCGAGCGATCCGCG[A/C]
CGCCGCCGTCCGCATGTAGCAGGAGGCGCAGATGGATATCGCTCATGCTCGTACGCTCCGTGTGCATGCCCTTCGCATGCGGCTGCGAGCGCAAGCAGAG

Reverse complement sequence

CTCTGCTTGCGCTCGCAGCCGCATGCGAAGGGCATGCACACGGAGCGTACGAGCATGAGCGATATCCATCTGCGCCTCCTGCTACATGCGGACGGCGGCG[T/G]
CGCGGATCGCTCGGACACGGCTGAGCTCCACTTGAGCACGGCGTCGCATGAGCACAGCGTGGAGACGAAGTGATCACGCGCGGGCGAACTCCACCTGCGC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.30%	18.70%	1.06%	0.00%	NA
All Indica	2759	75.90%	23.20%	0.91%	0.00%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	9.70%	81.00%	9.29%	0.00%	NA
Indica I	595	99.30%	0.70%	0.00%	0.00%	NA
Indica II	465	28.80%	69.70%	1.51%	0.00%	NA
Indica III	913	87.20%	11.40%	1.42%	0.00%	NA
Indica Intermediate	786	72.80%	26.60%	0.64%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	84.40%	15.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0427367311	A -> C	LOC_Os04g46200.1	upstream_gene_variant ; 4357.0bp to feature; MODIFIER	silent_mutation	Average:35.605; most accessible tissue: Callus, score: 49.755	N	N	N	N
vg0427367311	A -> C	LOC_Os04g46210.1	downstream_gene_variant ; 516.0bp to feature; MODIFIER	silent_mutation	Average:35.605; most accessible tissue: Callus, score: 49.755	N	N	N	N
vg0427367311	A -> C	LOC_Os04g46220.1	downstream_gene_variant ; 3551.0bp to feature; MODIFIER	silent_mutation	Average:35.605; most accessible tissue: Callus, score: 49.755	N	N	N	N
vg0427367311	A -> C	LOC_Os04g46200-LOC_Os04g46210	intergenic_region ; MODIFIER	silent_mutation	Average:35.605; most accessible tissue: Callus, score: 49.755	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0427367311	NA	7.13E-07	mr1050	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427367311	NA	5.99E-06	mr1155	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427367311	NA	1.07E-08	mr1174	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427367311	NA	1.58E-08	mr1174	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427367311	NA	9.00E-07	mr1193	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427367311	NA	2.40E-06	mr1272	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427367311	NA	2.71E-08	mr1354	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427367311	NA	8.48E-06	mr1733	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427367311	NA	2.74E-06	mr1798	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427367311	1.04E-06	1.04E-06	mr1035_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427367311	NA	2.98E-06	mr1050_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427367311	NA	3.17E-07	mr1158_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427367311	NA	1.92E-07	mr1167_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427367311	NA	3.43E-07	mr1272_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427367311	NA	3.26E-09	mr1354_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427367311	NA	2.64E-07	mr1478_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427367311	NA	4.17E-06	mr1543_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427367311	1.61E-06	2.08E-08	mr1631_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427367311	NA	1.50E-11	mr1715_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427367311	NA	2.07E-07	mr1720_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427367311	NA	6.07E-06	mr1726_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427367311	NA	4.98E-07	mr1733_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427367311	NA	3.43E-07	mr1895_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427367311	NA	1.22E-08	mr1904_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427367311	NA	2.35E-06	mr1928_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427367311	NA	5.61E-06	mr1928_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427367311	NA	1.09E-09	mr1931_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427367311	NA	1.56E-08	mr1931_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427367311	NA	1.88E-07	mr1942_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251