Variant ID: vg0427271689 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 27271689 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.01, others allele: 0.00, population size: 116. )
ATCGTTGAACTCGAACAAACTCAGTGGTATAGAATAGATTTTCTCATTTTTTTTGGGGGAAAAAGAGAAACAAATCCCCTAAGAACATGTAGTTACGGTC[G/A]
TCATCGTCATCGCCGTCACTGAGTTGCGTTTGTCACCACGCCCAGGACCAACGACCGTCATCAACCCACCGGGGCCGCGCCACTCGGGTCAGCAACCCGC
GCGGGTTGCTGACCCGAGTGGCGCGGCCCCGGTGGGTTGATGACGGTCGTTGGTCCTGGGCGTGGTGACAAACGCAACTCAGTGACGGCGATGACGATGA[C/T]
GACCGTAACTACATGTTCTTAGGGGATTTGTTTCTCTTTTTCCCCCAAAAAAAATGAGAAAATCTATTCTATACCACTGAGTTTGTTCGAGTTCAACGAT
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 55.90% | 43.70% | 0.13% | 0.19% | NA |
All Indica | 2759 | 35.10% | 64.40% | 0.18% | 0.33% | NA |
All Japonica | 1512 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
Aus | 269 | 8.90% | 91.10% | 0.00% | 0.00% | NA |
Indica I | 595 | 21.50% | 77.80% | 0.17% | 0.50% | NA |
Indica II | 465 | 10.50% | 88.80% | 0.22% | 0.43% | NA |
Indica III | 913 | 51.00% | 48.60% | 0.11% | 0.22% | NA |
Indica Intermediate | 786 | 41.50% | 58.00% | 0.25% | 0.25% | NA |
Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
Intermediate | 90 | 66.70% | 32.20% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0427271689 | G -> DEL | N | N | silent_mutation | Average:53.851; most accessible tissue: Zhenshan97 young leaf, score: 66.83 | N | N | N | N |
vg0427271689 | G -> A | LOC_Os04g46030.1 | upstream_gene_variant ; 2709.0bp to feature; MODIFIER | silent_mutation | Average:53.851; most accessible tissue: Zhenshan97 young leaf, score: 66.83 | N | N | N | N |
vg0427271689 | G -> A | LOC_Os04g46040.1 | upstream_gene_variant ; 156.0bp to feature; MODIFIER | silent_mutation | Average:53.851; most accessible tissue: Zhenshan97 young leaf, score: 66.83 | N | N | N | N |
vg0427271689 | G -> A | LOC_Os04g46050.1 | downstream_gene_variant ; 3526.0bp to feature; MODIFIER | silent_mutation | Average:53.851; most accessible tissue: Zhenshan97 young leaf, score: 66.83 | N | N | N | N |
vg0427271689 | G -> A | LOC_Os04g46050.2 | downstream_gene_variant ; 3526.0bp to feature; MODIFIER | silent_mutation | Average:53.851; most accessible tissue: Zhenshan97 young leaf, score: 66.83 | N | N | N | N |
vg0427271689 | G -> A | LOC_Os04g46050.3 | downstream_gene_variant ; 3526.0bp to feature; MODIFIER | silent_mutation | Average:53.851; most accessible tissue: Zhenshan97 young leaf, score: 66.83 | N | N | N | N |
vg0427271689 | G -> A | LOC_Os04g46030-LOC_Os04g46040 | intergenic_region ; MODIFIER | silent_mutation | Average:53.851; most accessible tissue: Zhenshan97 young leaf, score: 66.83 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0427271689 | NA | 9.62E-09 | mr1212_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0427271689 | NA | 7.22E-11 | mr1216_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0427271689 | NA | 8.16E-08 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0427271689 | NA | 4.03E-06 | mr1536_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0427271689 | 1.37E-06 | 1.37E-06 | mr1574_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0427271689 | NA | 1.52E-08 | mr1600_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0427271689 | 2.92E-06 | 2.92E-06 | mr1781_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |