\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0427232971:

Variant ID: vg0427232971 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 27232971
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.83, G: 0.11, C: 0.07, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


CAATCCAGCCCTGAAGGTAGGGCAGAGAATCCGGAGTGAGATGCAGACAAAAAAAAACCTGAAACCACGTTCATTTCAGCTCAGGGCTTCAGGCGGTAGC[T/C]
GGGCCAGAAAAAAGGGAGAAACGAAAAAGGGCAGGGCAGGACCGCAGGAGACGGTGCACTTCCGCTGACAGGTGGACCACAGACTACTGGTTTACTCGTA

Reverse complement sequence

TACGAGTAAACCAGTAGTCTGTGGTCCACCTGTCAGCGGAAGTGCACCGTCTCCTGCGGTCCTGCCCTGCCCTTTTTCGTTTCTCCCTTTTTTCTGGCCC[A/G]
GCTACCGCCTGAAGCCCTGAGCTGAAATGAACGTGGTTTCAGGTTTTTTTTTGTCTGCATCTCACTCCGGATTCTCTGCCCTACCTTCAGGGCTGGATTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.60% 40.10% 0.30% 0.00% NA
All Indica  2759 36.20% 63.40% 0.47% 0.00% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 56.10% 43.90% 0.00% 0.00% NA
Indica I  595 22.20% 76.60% 1.18% 0.00% NA
Indica II  465 11.00% 88.80% 0.22% 0.00% NA
Indica III  913 50.80% 49.20% 0.00% 0.00% NA
Indica Intermediate  786 44.70% 54.70% 0.64% 0.00% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 77.80% 21.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0427232971 T -> C LOC_Os04g45970.1 upstream_gene_variant ; 390.0bp to feature; MODIFIER silent_mutation Average:96.989; most accessible tissue: Callus, score: 98.801 N N N N
vg0427232971 T -> C LOC_Os04g45970.2 upstream_gene_variant ; 389.0bp to feature; MODIFIER silent_mutation Average:96.989; most accessible tissue: Callus, score: 98.801 N N N N
vg0427232971 T -> C LOC_Os04g45960-LOC_Os04g45970 intergenic_region ; MODIFIER silent_mutation Average:96.989; most accessible tissue: Callus, score: 98.801 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0427232971 T C -0.07 -0.11 -0.13 -0.08 -0.08 -0.07

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0427232971 NA 5.44E-06 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427232971 NA 1.54E-11 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427232971 NA 5.67E-10 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427232971 NA 2.60E-11 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427232971 NA 2.85E-06 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427232971 NA 2.46E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427232971 2.63E-06 NA mr1574_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427232971 3.55E-07 3.54E-07 mr1574_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427232971 NA 2.86E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427232971 3.19E-06 NA mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427232971 9.36E-06 9.35E-06 mr1781_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427232971 NA 3.99E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427232971 NA 2.62E-07 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427232971 NA 1.72E-07 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427232971 NA 4.46E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427232971 NA 9.27E-06 mr1852_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427232971 NA 1.84E-06 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251