Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0427084332:

Variant ID: vg0427084332 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 27084332
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, A: 0.03, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:

CGGTAAAACGCTGTTCGAATTGGAAAACACTATTCGAGTTGGAAAATACCGTTCGAGTACATTCTTGTCACTAAATCTCATTATCCGTTTTAAGTATTTC[C/A]
TGAGTTAATAACAGGTCAGCTACCGGATAAGTCGGAAAGGGTGGTCGAGCTGGAAAAGACTATTTGCCATGAAAAAGACCCATGGTGGTGGAAAAGACCC

Reverse complement sequence

GGGTCTTTTCCACCACCATGGGTCTTTTTCATGGCAAATAGTCTTTTCCAGCTCGACCACCCTTTCCGACTTATCCGGTAGCTGACCTGTTATTAACTCA[G/T]
GAAATACTTAAAACGGATAATGAGATTTAGTGACAAGAATGTACTCGAACGGTATTTTCCAACTCGAATAGTGTTTTCCAATTCGAACAGCGTTTTACCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.80%	36.10%	1.06%	0.00%	NA
All Indica	2759	37.40%	60.90%	1.70%	0.00%	NA
All Japonica	1512	99.70%	0.30%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	16.30%	81.00%	2.69%	0.00%	NA
Indica II	465	10.30%	88.00%	1.72%	0.00%	NA
Indica III	913	59.80%	39.20%	0.99%	0.00%	NA
Indica Intermediate	786	43.40%	54.80%	1.78%	0.00%	NA
Temperate Japonica	767	99.60%	0.30%	0.13%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	73.30%	25.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0427084332	C -> A	LOC_Os04g45750.1	upstream_gene_variant ; 3737.0bp to feature; MODIFIER	silent_mutation	Average:52.752; most accessible tissue: Zhenshan97 root, score: 80.909	N	N	N	N
vg0427084332	C -> A	LOC_Os04g45760.1	upstream_gene_variant ; 709.0bp to feature; MODIFIER	silent_mutation	Average:52.752; most accessible tissue: Zhenshan97 root, score: 80.909	N	N	N	N
vg0427084332	C -> A	LOC_Os04g45770.1	upstream_gene_variant ; 3552.0bp to feature; MODIFIER	silent_mutation	Average:52.752; most accessible tissue: Zhenshan97 root, score: 80.909	N	N	N	N
vg0427084332	C -> A	LOC_Os04g45750.2	upstream_gene_variant ; 3737.0bp to feature; MODIFIER	silent_mutation	Average:52.752; most accessible tissue: Zhenshan97 root, score: 80.909	N	N	N	N
vg0427084332	C -> A	LOC_Os04g45750-LOC_Os04g45760	intergenic_region ; MODIFIER	silent_mutation	Average:52.752; most accessible tissue: Zhenshan97 root, score: 80.909	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0427084332	NA	4.76E-15	mr1261	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084332	NA	1.36E-07	mr1610	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084332	NA	4.33E-06	mr1137_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084332	NA	2.92E-11	mr1138_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084332	NA	7.78E-13	mr1147_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084332	4.90E-06	NA	mr1204_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084332	NA	2.15E-08	mr1212_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084332	NA	3.70E-27	mr1270_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084332	NA	8.32E-07	mr1536_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084332	NA	1.01E-21	mr1551_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084332	NA	4.70E-13	mr1552_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084332	NA	1.97E-06	mr1762_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084332	NA	4.37E-08	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084332	NA	6.29E-08	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084332	2.99E-06	NA	mr1896_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084332	NA	3.08E-06	mr1896_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251