\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0427084332:

Variant ID: vg0427084332 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 27084332
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, A: 0.03, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


CGGTAAAACGCTGTTCGAATTGGAAAACACTATTCGAGTTGGAAAATACCGTTCGAGTACATTCTTGTCACTAAATCTCATTATCCGTTTTAAGTATTTC[C/A]
TGAGTTAATAACAGGTCAGCTACCGGATAAGTCGGAAAGGGTGGTCGAGCTGGAAAAGACTATTTGCCATGAAAAAGACCCATGGTGGTGGAAAAGACCC

Reverse complement sequence

GGGTCTTTTCCACCACCATGGGTCTTTTTCATGGCAAATAGTCTTTTCCAGCTCGACCACCCTTTCCGACTTATCCGGTAGCTGACCTGTTATTAACTCA[G/T]
GAAATACTTAAAACGGATAATGAGATTTAGTGACAAGAATGTACTCGAACGGTATTTTCCAACTCGAATAGTGTTTTCCAATTCGAACAGCGTTTTACCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.80% 36.10% 1.06% 0.00% NA
All Indica  2759 37.40% 60.90% 1.70% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 16.30% 81.00% 2.69% 0.00% NA
Indica II  465 10.30% 88.00% 1.72% 0.00% NA
Indica III  913 59.80% 39.20% 0.99% 0.00% NA
Indica Intermediate  786 43.40% 54.80% 1.78% 0.00% NA
Temperate Japonica  767 99.60% 0.30% 0.13% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 73.30% 25.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0427084332 C -> A LOC_Os04g45750.1 upstream_gene_variant ; 3737.0bp to feature; MODIFIER silent_mutation Average:52.752; most accessible tissue: Zhenshan97 root, score: 80.909 N N N N
vg0427084332 C -> A LOC_Os04g45760.1 upstream_gene_variant ; 709.0bp to feature; MODIFIER silent_mutation Average:52.752; most accessible tissue: Zhenshan97 root, score: 80.909 N N N N
vg0427084332 C -> A LOC_Os04g45770.1 upstream_gene_variant ; 3552.0bp to feature; MODIFIER silent_mutation Average:52.752; most accessible tissue: Zhenshan97 root, score: 80.909 N N N N
vg0427084332 C -> A LOC_Os04g45750.2 upstream_gene_variant ; 3737.0bp to feature; MODIFIER silent_mutation Average:52.752; most accessible tissue: Zhenshan97 root, score: 80.909 N N N N
vg0427084332 C -> A LOC_Os04g45750-LOC_Os04g45760 intergenic_region ; MODIFIER silent_mutation Average:52.752; most accessible tissue: Zhenshan97 root, score: 80.909 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0427084332 NA 4.76E-15 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084332 NA 1.36E-07 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084332 NA 4.33E-06 mr1137_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084332 NA 2.92E-11 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084332 NA 7.78E-13 mr1147_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084332 4.90E-06 NA mr1204_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084332 NA 2.15E-08 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084332 NA 3.70E-27 mr1270_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084332 NA 8.32E-07 mr1536_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084332 NA 1.01E-21 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084332 NA 4.70E-13 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084332 NA 1.97E-06 mr1762_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084332 NA 4.37E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084332 NA 6.29E-08 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084332 2.99E-06 NA mr1896_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084332 NA 3.08E-06 mr1896_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251