\
| Variant ID: vg0427073206 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 27073206 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 116. )
CCGTCTTATATGAAATTTTTTTATAATTAGTATTTTCGTTGTTGTTAGATGATAAAACATGATTAATACTTTATGTGTGACTTATCTTTTTAATTTTTTT[C/T]
ATAATTTTTTCAAATAAAATGAACGATCAAACGTTGGACACGAAAACCAAGGTTTGTCTTTTTTTGGGACGGAGGGATTAGCTATTTCCTATTAGCTTGA
TCAAGCTAATAGGAAATAGCTAATCCCTCCGTCCCAAAAAAAGACAAACCTTGGTTTTCGTGTCCAACGTTTGATCGTTCATTTTATTTGAAAAAATTAT[G/A]
AAAAAAATTAAAAAGATAAGTCACACATAAAGTATTAATCATGTTTTATCATCTAACAACAACGAAAATACTAATTATAAAAAAATTTCATATAAGACGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.30% | 11.80% | 1.90% | 0.00% | NA |
| All Indica | 2759 | 77.30% | 19.60% | 3.08% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.10% | 1.50% | 5.38% | 0.00% | NA |
| Indica II | 465 | 22.80% | 70.50% | 6.67% | 0.00% | NA |
| Indica III | 913 | 97.20% | 2.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 74.40% | 22.90% | 2.67% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 13.30% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0427073206 | C -> T | LOC_Os04g45750.1 | downstream_gene_variant ; 4161.0bp to feature; MODIFIER | silent_mutation | Average:55.894; most accessible tissue: Callus, score: 94.828 | N | N | N | N |
| vg0427073206 | C -> T | LOC_Os04g45750.2 | downstream_gene_variant ; 4161.0bp to feature; MODIFIER | silent_mutation | Average:55.894; most accessible tissue: Callus, score: 94.828 | N | N | N | N |
| vg0427073206 | C -> T | LOC_Os04g45740-LOC_Os04g45750 | intergenic_region ; MODIFIER | silent_mutation | Average:55.894; most accessible tissue: Callus, score: 94.828 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0427073206 | NA | 5.76E-07 | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427073206 | NA | 1.91E-07 | mr1050 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427073206 | NA | 1.85E-07 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427073206 | NA | 1.56E-06 | mr1057 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427073206 | NA | 7.39E-06 | mr1138 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427073206 | NA | 3.42E-07 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427073206 | NA | 1.01E-12 | mr1169 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427073206 | NA | 4.80E-06 | mr1169 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427073206 | NA | 3.58E-08 | mr1174 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427073206 | NA | 1.23E-06 | mr1272 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427073206 | NA | 9.31E-08 | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427073206 | NA | 6.32E-08 | mr1354 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427073206 | NA | 3.56E-06 | mr1502 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427073206 | NA | 2.79E-08 | mr1535 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427073206 | NA | 5.16E-09 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427073206 | NA | 6.98E-07 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427073206 | NA | 9.42E-06 | mr1733 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427073206 | 2.74E-06 | NA | mr1798 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427073206 | NA | 6.84E-08 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427073206 | NA | 4.39E-09 | mr1889 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427073206 | NA | 2.88E-08 | mr1896 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427073206 | NA | 3.71E-10 | mr1934 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427073206 | NA | 2.99E-09 | mr1935 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427073206 | NA | 1.00E-06 | mr1965 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427073206 | NA | 1.42E-07 | mr1989 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427073206 | NA | 5.80E-09 | mr1174_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427073206 | NA | 6.46E-10 | mr1354_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427073206 | NA | 6.42E-10 | mr1354_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427073206 | NA | 4.96E-11 | mr1715_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427073206 | NA | 8.02E-06 | mr1931_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427073206 | NA | 5.50E-06 | mr1931_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |