\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0426837648:

Variant ID: vg0426837648 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 26837648
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTCTCTCTCTTCTCTTCTTCTTCCTTTGGCTGTTCCCCAAAATCGGCCGGCGGCGCTAGGGTTGGCGATTACGGCGGCGATGGAGGGGGAAAGTGGTTG[C/T]
GGCCGAGGAGGGGAGGGAGCTAGGGTTCTCCGGCAACGGCGAGCGGCGGCGGAGGGGTTAATTTGATGTGTGGATGGGTTGTGGCTAGGGCGGCGGTGGC

Reverse complement sequence

GCCACCGCCGCCCTAGCCACAACCCATCCACACATCAAATTAACCCCTCCGCCGCCGCTCGCCGTTGCCGGAGAACCCTAGCTCCCTCCCCTCCTCGGCC[G/A]
CAACCACTTTCCCCCTCCATCGCCGCCGTAATCGCCAACCCTAGCGCCGCCGGCCGATTTTGGGGAACAGCCAAAGGAAGAAGAAGAGAAGAGAGAGAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.90% 8.30% 1.59% 0.28% NA
All Indica  2759 98.20% 0.70% 1.16% 0.00% NA
All Japonica  1512 72.80% 24.10% 2.31% 0.86% NA
Aus  269 99.30% 0.00% 0.74% 0.00% NA
Indica I  595 96.80% 0.50% 2.69% 0.00% NA
Indica II  465 97.40% 1.10% 1.51% 0.00% NA
Indica III  913 99.60% 0.20% 0.22% 0.00% NA
Indica Intermediate  786 98.00% 1.10% 0.89% 0.00% NA
Temperate Japonica  767 96.20% 3.10% 0.65% 0.00% NA
Tropical Japonica  504 34.30% 58.10% 5.16% 2.38% NA
Japonica Intermediate  241 78.40% 19.50% 1.66% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 84.40% 8.90% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0426837648 C -> DEL N N silent_mutation Average:62.663; most accessible tissue: Minghui63 young leaf, score: 82.368 N N N N
vg0426837648 C -> T LOC_Os04g45380.1 downstream_gene_variant ; 1132.0bp to feature; MODIFIER silent_mutation Average:62.663; most accessible tissue: Minghui63 young leaf, score: 82.368 N N N N
vg0426837648 C -> T LOC_Os04g45370-LOC_Os04g45380 intergenic_region ; MODIFIER silent_mutation Average:62.663; most accessible tissue: Minghui63 young leaf, score: 82.368 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0426837648 NA 8.37E-14 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426837648 NA 9.86E-22 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426837648 NA 2.23E-07 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426837648 5.00E-09 9.92E-39 mr1699 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426837648 NA 3.17E-21 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426837648 NA 3.89E-12 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426837648 NA 1.09E-15 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426837648 NA 5.17E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426837648 NA 5.04E-15 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426837648 NA 1.33E-06 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426837648 NA 1.94E-22 mr1676_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426837648 NA 2.04E-09 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426837648 NA 3.07E-32 mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426837648 NA 3.32E-09 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426837648 NA 1.34E-12 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426837648 NA 2.59E-13 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426837648 2.74E-07 NA mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251