\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0426596087:

Variant ID: vg0426596087 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 26596087
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACAAAATTTATAAATAGCTAAAAACGATATGGTCAGAAATTGTACCCTTTATACGAAAACGATACTCGCTTAATCAGGAATTTCCATGACCGTTTTCAC[A/C]
ACCATCACGTGTATGCTTGGCAACACGTCGTCTTCGATCTCTGGATACACCAGCACAAGTAGCATATACCATATAATAGTAGGAGCAATCTTTTCATAGT

Reverse complement sequence

ACTATGAAAAGATTGCTCCTACTATTATATGGTATATGCTACTTGTGCTGGTGTATCCAGAGATCGAAGACGACGTGTTGCCAAGCATACACGTGATGGT[T/G]
GTGAAAACGGTCATGGAAATTCCTGATTAAGCGAGTATCGTTTTCGTATAAAGGGTACAATTTCTGACCATATCGTTTTTAGCTATTTATAAATTTTGTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.30% 14.40% 1.33% 0.00% NA
All Indica  2759 97.20% 2.00% 0.87% 0.00% NA
All Japonica  1512 57.60% 39.90% 2.45% 0.00% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 95.30% 3.90% 0.84% 0.00% NA
Indica II  465 96.60% 1.90% 1.51% 0.00% NA
Indica III  913 99.50% 0.40% 0.11% 0.00% NA
Indica Intermediate  786 96.30% 2.30% 1.40% 0.00% NA
Temperate Japonica  767 29.30% 67.40% 3.26% 0.00% NA
Tropical Japonica  504 92.30% 6.90% 0.79% 0.00% NA
Japonica Intermediate  241 75.10% 21.60% 3.32% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 80.00% 17.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0426596087 A -> C LOC_Os04g44950.1 upstream_gene_variant ; 3685.0bp to feature; MODIFIER silent_mutation Average:55.949; most accessible tissue: Zhenshan97 flower, score: 72.578 N N N N
vg0426596087 A -> C LOC_Os04g44960.1 upstream_gene_variant ; 2634.0bp to feature; MODIFIER silent_mutation Average:55.949; most accessible tissue: Zhenshan97 flower, score: 72.578 N N N N
vg0426596087 A -> C LOC_Os04g44950-LOC_Os04g44960 intergenic_region ; MODIFIER silent_mutation Average:55.949; most accessible tissue: Zhenshan97 flower, score: 72.578 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0426596087 NA 1.08E-14 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0426596087 NA 5.19E-14 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0426596087 NA 3.45E-07 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426596087 NA 1.73E-06 mr1097 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426596087 NA 7.59E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426596087 NA 1.66E-06 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426596087 NA 1.71E-07 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426596087 2.34E-06 NA mr1546_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426596087 NA 7.70E-08 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426596087 NA 1.71E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426596087 NA 9.67E-09 mr1627_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426596087 NA 1.82E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426596087 NA 3.88E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251