Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0426596087:

Variant ID: vg0426596087 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 26596087
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AACAAAATTTATAAATAGCTAAAAACGATATGGTCAGAAATTGTACCCTTTATACGAAAACGATACTCGCTTAATCAGGAATTTCCATGACCGTTTTCAC[A/C]
ACCATCACGTGTATGCTTGGCAACACGTCGTCTTCGATCTCTGGATACACCAGCACAAGTAGCATATACCATATAATAGTAGGAGCAATCTTTTCATAGT

Reverse complement sequence

ACTATGAAAAGATTGCTCCTACTATTATATGGTATATGCTACTTGTGCTGGTGTATCCAGAGATCGAAGACGACGTGTTGCCAAGCATACACGTGATGGT[T/G]
GTGAAAACGGTCATGGAAATTCCTGATTAAGCGAGTATCGTTTTCGTATAAAGGGTACAATTTCTGACCATATCGTTTTTAGCTATTTATAAATTTTGTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.30%	14.40%	1.33%	0.00%	NA
All Indica	2759	97.20%	2.00%	0.87%	0.00%	NA
All Japonica	1512	57.60%	39.90%	2.45%	0.00%	NA
Aus	269	97.80%	2.20%	0.00%	0.00%	NA
Indica I	595	95.30%	3.90%	0.84%	0.00%	NA
Indica II	465	96.60%	1.90%	1.51%	0.00%	NA
Indica III	913	99.50%	0.40%	0.11%	0.00%	NA
Indica Intermediate	786	96.30%	2.30%	1.40%	0.00%	NA
Temperate Japonica	767	29.30%	67.40%	3.26%	0.00%	NA
Tropical Japonica	504	92.30%	6.90%	0.79%	0.00%	NA
Japonica Intermediate	241	75.10%	21.60%	3.32%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	80.00%	17.80%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0426596087	A -> C	LOC_Os04g44950.1	upstream_gene_variant ; 3685.0bp to feature; MODIFIER	silent_mutation	Average:55.949; most accessible tissue: Zhenshan97 flower, score: 72.578	N	N	N	N
vg0426596087	A -> C	LOC_Os04g44960.1	upstream_gene_variant ; 2634.0bp to feature; MODIFIER	silent_mutation	Average:55.949; most accessible tissue: Zhenshan97 flower, score: 72.578	N	N	N	N
vg0426596087	A -> C	LOC_Os04g44950-LOC_Os04g44960	intergenic_region ; MODIFIER	silent_mutation	Average:55.949; most accessible tissue: Zhenshan97 flower, score: 72.578	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0426596087	NA	1.08E-14	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0426596087	NA	5.19E-14	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0426596087	NA	3.45E-07	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426596087	NA	1.73E-06	mr1097	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426596087	NA	7.59E-07	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426596087	NA	1.66E-06	mr1097_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426596087	NA	1.71E-07	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426596087	2.34E-06	NA	mr1546_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426596087	NA	7.70E-08	mr1570_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426596087	NA	1.71E-08	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426596087	NA	9.67E-09	mr1627_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426596087	NA	1.82E-07	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426596087	NA	3.88E-06	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251